Here is the study guide for Test #5, which will be held in class on Dec. 7.
Study Guide for Test 5
Chapter 13
1. Know how RNA and DNA differ.
2. Know the mechanics of transcription and translation, including
a. where energy is consumed and what energy molecules are used.
b. the details of initiation, elongation, and termination in both transcription and translation.
3. Know how the 4-letter language of nucleic acids can be converted into the 20-word language of amino acid.
4. Know why only one strand of DNA is transcribed into mRNA.
5. Know the parts of a t-RNA, including amino acid binding site and anti-codon site.
6. Know the start codon and what amino acid it codes for.
7. Know the action of peptidyl tranferase.
8. Know about the universal nature of codons and its implication for translation of human mRNA in other eukaryotic cells.
9. Know how eukaryotic mRNA’s are modified and the ‘reason’ for each type of modification.
10. Know the flow of information in most organisms and how this flow is different in retroviruses.
11. Know the following definitions and their effects on the gene: deletion mutation, addition mutation, frameshift mutation, substitution mutation, nonsense mutation, and misssense mutation.
12. Be able to read a codon chart. Be able to determine the mRNA that would be transcribed from a template or nontemplate DNA strand and what amino acids the mRNA would code for.
Chapter 18
13. Know the following definitions of the following terms: evolution, population, community, individual, ecosystem, biosphere, synthetic theory of evolution.
14. Know that evolution is caused by natural selection.
15. Know the components of natural selection.
16. Know the difference between natural and artificial selections. Know specific examples of artificial selection, specifically the broccoli family and domestic dogs.
17. Know the names of the individuals who influenced Darwin’s theory and how they influenced him.
18. Know the details of Darwin’s ‘voyage of discovery’.
19. Know the following tenants of natural selection: variation, overproduction, competition, differential reproductive success.
20. Know how mutations effect natural selection.
21. Know how each of the following provides evidence for the theory of evolution: fossil record, biogeography, comparative biology, developmental biology, comparative molecular biology, experimentation. Know examples and details of each.
22. Know the following definitions and examples of each: homologous features, homoplastic features, convergent evolution, vestigial structures, molecular clocks, .
Chapter 19
23. Know how to calculate phenotype frequencies, genotype frequencies, and allele frequencies.
24. Know the Hardy-Weinberg principle equation.
25. Know what contributes to stability or change within a population.
26. Know how random breeding, inbreeding, assortative mating, genetic drift, founder effect, stabilizing selection, directional selection, disruptive selection change phenotypes, genotypes, and allele frequencies.
27. Know how sickle-cell trait is beneficial to those who have the heterozygotic condition.
Wednesday, December 2, 2009
Wednesday, November 11, 2009
Practice Chart for the Citric Acid Cycle
Friday, November 6, 2009
Study Guide for Test 3
Study Guide for Test 3
Chapter 7
1. Know the ultimate source of energy for almost all living organisms.
2. Know the following terms: energy (both kinetic, potential, and chemical), mass, entropy, enthalpy, catabolism, anabolism, metabolism, dynamic equilibrium, endogonic reactions, and exogonic rections.
3. Know the 1st and 2nd Laws of Thermodynamics and their applications.
4. Know how a cell maintains a high degree of order.
5. Know how endogonic and exogonic reactions are coupled. Know how ATP stores energy.
6. Know how electrons/proton transfer transfers energy in redox reactions. Know the molecules that are involved in energy transfer in redox reactions.
7. Know how enzymes function as catalysts, including induced fit, active sits, allosteric sites, allosteric regulation, cofactors, and apoenzymes.
Chapter 8
8. Know, in detail, glycolysis and citric acid cycle. This includes the molecules involved, the names of the molecules, the names of enzymes involved, and energy molecules involved. Be able to fill in each on a blank chart.
9. For extra credit, know in detail the formation of acteyl CoA from pyruvate.
10. Know in detail the electron transport chain of mitochondria. Know the function and process of chemiosmosis.
Chapter 9
11. Know the order of electromagnetic radation, from shortest wavelength to longest.
12. Know how a photon can energize an electron. Know how chloroplasts use this to gain energized electrons for their electron transport chain.
13. Know the composition of chlorophyll, particularly the inorganic atom at its center.
14. Know the parts of the chloroplast and their functions.
15. Know the parts of the leaf and their functions.
16. Know the overall reaction of photosynthesis and which molecules are reduced and which are oxidized.
17. Know, in detail, the light dependant and carbon-fixation reactions. Know where each reaction takes place. Know the reactants and products of both sets of reactions.
18. Know the difference between C3, C4, and CAM plants. Know how each type of carbon-fixation reaction differs.
19. Know the various trophic groups and examples of each.
Chapter 7
1. Know the ultimate source of energy for almost all living organisms.
2. Know the following terms: energy (both kinetic, potential, and chemical), mass, entropy, enthalpy, catabolism, anabolism, metabolism, dynamic equilibrium, endogonic reactions, and exogonic rections.
3. Know the 1st and 2nd Laws of Thermodynamics and their applications.
4. Know how a cell maintains a high degree of order.
5. Know how endogonic and exogonic reactions are coupled. Know how ATP stores energy.
6. Know how electrons/proton transfer transfers energy in redox reactions. Know the molecules that are involved in energy transfer in redox reactions.
7. Know how enzymes function as catalysts, including induced fit, active sits, allosteric sites, allosteric regulation, cofactors, and apoenzymes.
Chapter 8
8. Know, in detail, glycolysis and citric acid cycle. This includes the molecules involved, the names of the molecules, the names of enzymes involved, and energy molecules involved. Be able to fill in each on a blank chart.
9. For extra credit, know in detail the formation of acteyl CoA from pyruvate.
10. Know in detail the electron transport chain of mitochondria. Know the function and process of chemiosmosis.
Chapter 9
11. Know the order of electromagnetic radation, from shortest wavelength to longest.
12. Know how a photon can energize an electron. Know how chloroplasts use this to gain energized electrons for their electron transport chain.
13. Know the composition of chlorophyll, particularly the inorganic atom at its center.
14. Know the parts of the chloroplast and their functions.
15. Know the parts of the leaf and their functions.
16. Know the overall reaction of photosynthesis and which molecules are reduced and which are oxidized.
17. Know, in detail, the light dependant and carbon-fixation reactions. Know where each reaction takes place. Know the reactants and products of both sets of reactions.
18. Know the difference between C3, C4, and CAM plants. Know how each type of carbon-fixation reaction differs.
19. Know the various trophic groups and examples of each.
Monday, November 2, 2009
Lectures 11 - 13, 18 - 19
Chapter 11
Outline
I. Mendel’s principles of inheritance
A. Gregor Mendel
1. Monk in Austria, published work in 1866, not recognized until 1900.
2. Performed experiments with garden pea plants, results of which became the foundation of genetics.
B. Pea plant crosses
1. Before Mendel, breeders of animals and plants knew about true-breeding stock and hybrids.
a. True-breeding stock produce off-spring that are the same, and so on
All have the same phenotype (physical appearance of an organism)
Genotype - genetic composition of an organisms - all genes may not be expressed
b. Hybrids are the result of a cross of true-breeding stock. Hybrids are similar but their off-spring are different, with mixed traits.
2. Other researchers had picked models that were not good for beginning:
a. Humans and calico cats – too complicated, generations are too long.
3. Peas are simpler -
a. Easy to grow, easy to control pollenation/breeding, several varieties commercially available, short generations.
b. Mendel selected plants with seven characteristics, two variations only.
c. Alleles - alternative forms of a gene - informational unit.
d. Flower color - white & purple; seed color – yellow & green; seed shape – smooth & wrinkled; stem height – tall & short, etc.
4. Mendel purchased seeds that were true-breeding
a. Raised them for several generations to be sure.
b. Called the P or parental generation.
5. Performed various crosses of the P generation.
a. F1 generation - first cross (1st filial [Latin, sons & daughters] generation).
b. F2 generation - cross of the F1 plants.
6. Previous thought had been that inheritance involved blending of traits.
a. Breed a tall plant with a short plant and you will get a medium-sized plant.
b. Mendel’s pea plants showed a different result - F1 plants all tall, F2 plants, 2/3 tall, 1/3 short.
II. Prediction of monohybrid crosses
A. Monohybrid crosses
1. Punnett square
2. Tall (T) & short (t) stems
3. Purple (P) & white (p) flowers
4. 3:1 ratio
5. Terms
a. Monohybrid cross - involves individuals with different alleles of a given locus
b. Locus - designates the position of a gene on the chromosome (Fig 11-5 on page 239).
c. Dominate - factor/gene expressed in F1
d. Recessive - factor/gene masked by the dominate gene when both are present.
e. Homozygous - have the same allele on homologous chromosomes (either dominate or recessive).
f. Heterozygous - have different alleles on homologous chromosomes
B. Principles of segregation and independent assortment
1. Principle of segregation - before sexual reproduction occurs, the two alleles by an individual parent must become separated (that is segregated).
a. During meiosis, homologous chromosomes (and genes on them) separate.
b. Alleles go not mix or destroy each other.
c. Recessive genes are not lost can reappear in later generations
2. Principle of independent assortment - members of any gene pair segregate from one another independently of the members of the other gene pairs.
a. Each gamete contains one allele for each locus.
b. Alleles of different loci are assorted at random with respect to each other in the gametes.
B. Test crosses
1. Guinea pigs (Fig 11-7) - want to know if a black guinea pig is homozygous or heterozygous
2. Breed with a homozygous recessive guinea pig and check the results.
3. ½ black and ½ brown - heterozygous
4. All black - probably homozygous
Why probably? Because of heterozygous have an equal change of producing gametes carrying the black or brown allele - by change, all the off-spring may have only received the dominate gene.
Example of black haired, brown-eyed Italian father; blonde, blue-eyed mother with two blonde, blue-eyed children.
C. Dihybrid crosses
1. Guinea pigs (Figure 11-8 on page 242).
2. Black, short-haired dominate; brown, long-haired recessive
3. F1 - all black, short-haired
4. F2 - ratio 9:3:3:1
Hair color and hair length separate independently
9/16 will be black, short-haired
3/16 will be black, long-haired
3/16 will be brown, short-haired
1/16 will be brown, long-haired
5. Blood type example - ABO and Rh factor
III. Gene linkage
A. Work with the fruit fly, Drosophila melanogaster.
1. Did not follow classic Mendelian genetics
2. Figure 11-11 on page 246
3. Of 2300 off-spring, expected 1/4 of off-spring to be from each independent assortment phenotype.
4. In the actual results, 83% belonged to each of the two parental classes, and 17% belonged to the two recombinant classes.
5. Determined that wing shape and body color are linked, or on the same chromosome.
6. Because they are on the same chromosome, they do not assort independently.
B. Frequency of crossing-over
1. If on the same chromosome, how do we get any recombinant phenotypes?
2. Crossing-over during meiosis
Homologous chromosomes line up - synapsis.
Enzymes break the chromosomes and reattach the pieces on the homologous chromosome.
3. Use frequency of crossing-over to determine linear order of linked genes.
Use data to determine percentage of crossing-over.
Divide number of individuals in the two recombinant classes of offspring by total number of offspring and multiply by 100
Fruit fly example: (391/2300)*100 = 17%
V locus and B locus have 17% recombination between them.
Crossing-over more likely to occur if loci are further apart on the chromosome.
Map units - 1% recombination between two loci equals a distance of 1 map unit apart.
V and B loci are 17 map units apart.
4. Fig 11-13 on page 248 - Gene mapping
IV. Sex chromosomes
A. Inheritance of sex
1. Sex determined by different factors in different species.
2. Alligators - temperature
3. Most species, genes are the most important factor.
4. Some species, specific sex chromosomes - rest called autosomes.
a. In mammals, the Y chromosome determines male sex.
b. Several genes on Y chromosome contribute to male developement.
c. Sex reversal on Y (SRY) gen is the major male-determining gene on the Y chromosome, acts as a ‘genetic switch’ that causes testes to develop in the fetus.
d. Testes produce testosterone, which causes other male characteristics to develop.
e. Some genes on X chromosome, some on autosomes.
f. Evidence suggests that X & Y chromosomes were originally a homologous pair, but the Y chromosome lost most of its genetic material. Functional genes preserved on the X chromosome.
B. X-linked genes
1. Because X & Y can’t line up for synapsis, cross-over is very rare/nonexistent.
2. Genes located on the X-chromosome have unusual heiritance patterns.
3. Used to be called ‘sex-linked genes’, because they are on a sex chromosome, but now called ‘X-linked genes’ which is more appropriate. Genes on X-chromosome are not necessarily linked to sex/sex development.
a. Color perception
b. Blood clotting
4. Figure 11-16 on page 250 - X-linked red-green color blindness
a. Normal father with carrier mother - half sons will be red-green color blind and half daughters will be carriers.
b. Color-blind father with carrier mother - half children (male and female) will be color blind and all normal daughters will be carriers.
C. Dosage compensation
1. Female mammals have potentially double-dose of X-genes from both homologous X-chromosomes.
2. Dosage compensation is a mechanism that makes equivalent the two doses in the female and the single dose in the male.
3. Dosage compensation in humans and other mammals involves the random inactivation of one/most of one of the X-chromosomes.
a. During interphase, a dark spot of chromatin is visible at the edge of the nucleus of each female mammalian cell when stained and observed under the microscope.
b. Barr body - dense metabolically inactive X chromosome.
c. 25% of the genes are expressed to some degree.
4. Calico cats - X-linked genes for black and yellow/orange fur (white different gene.
5. Sweat gland expression in humans.
6. Color-blindness - patches of color-blind cells in the retina, normal patches make up the difference.
V. Extensions of Mendelian Genetics
A. Pleiotropy - multiple affects from one gene.
1. Homozygous for recessive allele that causes cystic fibrosis produce abnormally thick mucus in many areas of the body, including respiratory, digestive, and reproductive systems.
a. Two CF parents will have CF children.
b. One CF parent and a normal parent will have all carrier children, unless the normal parent is a carrier, then 50% CF, 25% carrier, 25% non-carrier.
2. Dwarfism - dominate allele for abnormal growth of bones
a. Achondroplaisa - normal sized truck, short limbs, and slightly enlarged head.
b. 70% of all dwarfism
c. May have problems with apnea (central & obstructive) and hydrocephalus
d. Two achondroplaisic parents have 25% chance of a non-dwarf child, 50% of a dwarf child, and 25% of a double-dominate child (fatal)
B. Dominance is not always complete
1. Incomplete dominance - instances in which the heterozygote is intermediate in phenotype
a. Four o’clocks - red + white = pink in F1
b. Not ‘blending’ - red and white show up in F2, genes not ‘lost’
c. Red pigment ‘dosage’ dependant - two genes produce red, one gene produces pink, white in gene that doesn’t code for pigment.
2. Codominance - instances in which the heterozygote simultaneously expresses the pheotypes of both types of homozygotes
a. ABO blood groups
C. Multiple alleles
1. Some genes have multiple alleles
2. Rabbit coat color - sequential dominance
a. Fig 11- 19 on page 254
b. C>cch>ch>C
c. Predict cross between different rabbit coat colors
3. Some alleles of different loci may interact to produce a phenotype.
a. Chickens - two genes on different chromosomes (unlinked).
b. Rose comb [R] vs single comb [r]
c. Pea comb (P) vs single comb (p)
d. Fig 11-20 on page 254
4. Epistasis (standing on) - common type of gene interaction in which the presence of certain alleles of one locus can prevent or mask the expression of alleles of a different locus and express their own phenotype instead.
a. No novel phenotypes are produced.
b. Labrador retrievers coat color - gene for pigment and gene for depositing color in the coat.
c. Black coat (B) vs brown coat (b)
d. Expression of color/depositing color (E) vs blocking color (e, eistatic).
e. e is recessive and blocks expression of B/b.
f. Fig 11-12 on page 255.
5. Polygenic inheritance - when multiple independent pairs of genes have similar and additive effects on the same character.
a. Human skin pigment - as many as 60 loci found so far.
b. Incompletely dominate - more capital letters, darker the skin.
c. For simplicity, limit to three independent loci, A/a, B/b, C/c
d. Fig 11-22 on page 256.
Chapter 12
Outline
DNA Replication
I. General structure of DNA molecule
A. Contributors and ‘pieces’ discovered
1. Erwin Chargaff - Chargaff’s rules.
a. Reports relationships among DNA bases that provide a clue to the structure of DNA.
b. Ratios of purines (adenine, guanine) to pyrimidines (thymine, cytosine) and also adenine to thymine and guanine to cytosine were not far from 1.
2. Franklin & Wilkins
a. Rosalind Franklin - performed the X-ray diffraction on DNA crystals that showed DNA has a helical structure.
b. Maurice Wilkins was the head of the lab, received the Nobel Prize
3. Watson and Crick
a. Used information from other researchers to put together a model that reflected the data.
b. Used Franklin’s X-ray data for a helical/double helical structure and distance between the nucleotide bases and turns of the helix.
c. Used Chargaff’s data of the 1:1 ration of adenine:thymine, guanine:cystosine to determine that pairing keeps the distance between the two helixes the same. H-bonding is favored, too.
d. Determined the two helixes would need to be antiparallel to each other.
3. Meselson and Stahl
a. Demonstrated semiconservative replication.
b. Fig 12-7, page 268.
c. 15N labeled DNA in E. coli. 15N labeled DNA heavier than normal 14N DNA.
d. Isolated DNA by density gradient centrifugation for a heavy base reading.
e. Grew E. coli in normal media for one generation (20 minutes).
f. Isolated DNA - intermediate density of all 14N labeled DNA - supported semiconservative (one helix is the template for new strand) and dispersive (parental and new strands are randomly mixed during replication) replication. Conservative (both parent strands remain together, as would the new strands) would have had two bands.
g. Second generation had two bands of DNA, one intermediate and one light - supported semiconservative. Dispersive would have had one band again, but less dense.
B. Final picture
1. Double helix
2. Pairing of adenine and thymine; guanine and cystosine.
3. Replication by semiconservative replication.
II. DNA replication
A. General Process
1. Helix ‘unzipped’.
2. New strand formed by pairing with nucleotide bases.
3. Duplicated DNA has one parental strand and one new strand - two helixes total.
B. Detailed Process (Fig 12-11, page 272; Fig. 12-12, page 273)
1. Major enzyme groups (Table 12-3, page 270)
2. Helicases ‘unzip’ the helix by breaking H-bonds between nucleotide bases.
3. Single-strand binding (SSB) proteins bind to single DNA to:
a. Prevent strands from reannealing
b. Prevent hydrolysis of strands by nucleases
4. Topoisomerases produce breaks in the DNA to unwind the helix - relieve supercoiling produced by the helicases.
5. DNA primase
a. Produce a RNA primer (5 - 14 nucleotides) for the start of replication.
b. Replication proceeds from 5' to 3' of an existing polynucleotide strand.
6. DNA polymerases
a. Add nucleotides to 3' of the growing strand.
b. Nucleotides with three phosphate groups brought in.
c. Nucleotide paired with base of the template strand.
d. As nucleotide is linked, two phosphates leave - strongly exergonic reaction.
e. Polynucleotide chain is elongated by linkage of the 5' phosphate group to the 3' hydroxyl group of the sugar at the end of the existing strand - always synthesis from 5' to 3'.
7. Leading strand vs lagging strand
a. Replication happening on both sides of the replication fork.
b. One strand is replicated continuously (5' - 3' direction toward replication fork) and is called the leading strand.
c. Other strand is replicated discontinuously (5' - 3' direction away from replication fork) and is called the lagging strand.
d. Lagging strand is replicated in ‘pieces’ called Okazaki fragments.
e. Okazaki fragments replicated until come to RNA primer, DNA polymerase degrades and replaces the RNA primer with DNA
f. Starts again further up the strand toward the replication fork.
8. DNA ligase
a. Joins the DNA fragments by linking the 3' hydroxyl group with the 5' phosphate fo the DNA next to it, forming a phosphodiester linkage.
b. Also joins breaks in non-replicating DNA.
9. Number of replication forks
a. Multiple replication forks in eukaryotic cells - replication precedes faster.
b. Prokaryotic cells have circular DNA strands - one origin of replication, fewer bases.
c. Either way, forks meet and merge.
10. Telomerases cap eukaryotic chromosome ends.
a. Because eukaryotic chromosomes are linear, some DNA is lost on the end.
b. Not a problem because ends are composed of telomeres, stretches of short, simple, noncoding DNA sequences the repeat many times.
c. Human gametes 5'—TTAGGG—3'
d. Cell can divide many times before start losing essential genetic information.
e. Telomerases lengthen telomeric DNA by adding repetitive nucleotide sequences to the ends of eukaryotic chromosomes.
Active in rapidly dividing cells - germ cell lines, blood cells, skin cells, etc.
Telomere shortening implicated in cell aging and apoptosis - some cells only divide a certain number of times then die.
Cancer cells - telomeres shorten to critical lengths, telomerases kick in rather than the cells dying.
Balance between controlled immortality and cancer.
Chapter 13
Outline
Gene Expression
I. Overview of RNA
A. Difference between RNA & DNA
1. Draw structures
2. Ribose vs deoxyribose - OH group on the 2' carbon atom
3. Uracil vs thymine
4. Both joined 5' to 3'
5. Both have purines H-bonding with prymidines
B. Three Main Types of RNA
1. mRNA - single strand of RNA that carries the information for making a protein.
2. tRNA
a. Single strand of RNA that folds bac on itself to form a specific shape.
b. Each kind of tRNA bonds with only one kind of amino acid and carries it to the ribosome.
c. Because there are more kinds of tRNA molecules than there are amino acids, many amino acids are carried by two or more kinds of tRNA molecules.
3. rRNA
a. Is in a globular form.
b. Is an important part of the structure of ribosomes.
c. Has catalytic functions needed during protein synthesis.
d. rRNA made in nucleolar organizer in the nucleolus. Proteins needed for ribosomes synthesized in the cytoplasm, imported into the nucleolus, where the ribosomes are assembled.
4. Rest of the major groups are in Table 13-1, page 296. We’ll cover some of them as we go along.
II. From DNA to proteins
A. DNA genetic code
1. Triplet code
a. DNA has four bases.
b. If each base coded for one amino acid, it could only could for four amino acids.
c. Twenty amino acids commonly found in cells.
d. If each base served as a letter in a four-letter "alphabet", could code for more amino acids.
e. If each ‘word’ consisted of three ‘letters’, could ‘spell’ 64 ‘words’, more than enough to code for all the naturally occurring amino acids.
2. Codons
a. Each three base ‘word’ is called a codon.
b. Figure 13-5 on page 284.
c. More than one codon specifies certain amino acids - the code is redundant - ‘wobble’ at 3' end of the triplet.
d. Code is nearly universal - same in bacteria, yeast, and humans.
e. Some codons do not specify an amino acid, but ‘punctuation’, such as ‘start’ and ‘stop.’
3. Using the chart, ‘spell’ out examples of proteins.
a. Example one
Non-template DNA strand
5' - ATGTTTGGTGGTTTA - 5'
Template DNA strand
3' - TACAAAGGTCCAAAT - 5'
mRNA strand
5' - AUGUUUCCAGGUUUA - 3'
Codons indicated
AUG/UUU/CCA/GGU/UUA
Find codons on the chart for amino acids/instructions coded
Met (start)/Phe/Pro/Gly/Stop
b. Example two
Non-Template DNA strand
5' - ATGGTGTCACGAUGA - 3'
Template DNA strand
3' - TACCTCTGTGGTACT - 5'
mRNA strand
5' - AUGGUGUCACGAUGA - 3'
Codons indicated
AUG/GUG/UCA/CGA/UGA
Have students find codons on the chart
Met (start)/Val/Ser/Arg/Stop
c. Example three
Non-Template DNA strand
5' - ATGGGGCAGAGCGTGATTTAA - 3'
Template DNA strand
3' - TACCCCGTCTCGCACTAAATT - 5'
mRNA strand
5' - AUGGGGCAGAGCGUGAUUUAA - 3'
Codons indicated
AUG/GGG/CAG/AGC/GUG/AUU/UAA
Find codons on the chart
Met (start)/Gly/Gln/Ser/Val/Ile/Stop
B. Transcription
1. Unwinding of the DNA molecule from the histones.
a. Like in replication, must unwind and ‘unzip’ to be ‘seen.’
b. Part of gene regulation is modifying the DNA molecule so it can be exposed or not.
2. DNA-dependent RNA polymerases
a. Types of RNA polymerases
RNA polymerase I catalyzes the synthesis of several kinds of rRNA molecules that are components of the ribosome.
RNA polymerase II catalyzes the production of the protein-coding mRNA
RNA polymerase III catalyzes the synthesis of tRNA and one of the rRNA molecules.
b. Behavior
Require DNA as a template (‘DNA-dependent’ portion of the name).
Carry out synthesis in the 5' 6 3' direction - begin at the 5' end of the RNA molecule being synthesized then continue to add nucleotides at the 3' end until the molecule is complete.
Use nucleotides with three phosphate groups (like ATP, GTP), two phosphate groups come off after polymerization.
Doesn’t require a RNA primer.
3. Synthesis of mRNA
a. Initiation
Promoter - nucleotide sequence in DNA to which RNA polymerase and associated proteins initially bind.
Promoter is not transcribed (no mRNA made from it) – the RNA polymerase moves past it before beginning transcription.
Promoters slightly different for each gene - another method of control.
Promoters upstream (toward 5' end of the mRNA sequence, toward the 3' end of the template DNA) of the point where transcription will begin.
Once RNA polymerase recognizes the promoter, unwinds DNA molecule and initiates transcription.
b. Elongation
First RNA nucleotide retains its triphosphate group on the 5' end.
During elongation, each RNA nucleotide added to the 3' end loses two of the phosphate groups in an exergonic reaction.
Remaining phosphate group is incorporated into the phosphate sugar backbone.
Terminal 3' end has an exposed OH group.
c. Termination
Elongation continues until the RNA polymerase recognizes a termination squence.
This signal leads to a separation of RNA polymerase from the template DNA and the newly synthesized RNA.
Prokaryotes - termination signal causes the RNA polymerase to separate from the DNA template strand and the newly synthesized mRNA strand.
Eukaryotes - after termination signal, RNA polymerase adds nucleotides (about 10 - 35) before seperating.
4. Use examples from II.A. for transcription.
5. Mutations (Figure 13 - 20, page 299)
a. Base substitution
Involves a change in only one pair of nucleotides.
Usually result from errors in base pairing during replication.
b. Missense
Base substitutions that result in replacement of one amino acid by another.
Missense mutations have a wide range of effects.
Occurs at or near enzyme active site with a replacement by a very different amino acid (acid replacing a basic amino acid) - enzyme activity may be decreased or completely inactivated.
Replacement of a very different amino acid occurs further away from active site - enzyme may be unaffected, if folding is unaffected.
Replacement with a very similar amino acid (acid for acid), may not change anything - a silent mutation.
c. Nonsense
Base substitutions that covert an amino acid-specifying codon to a stop codon.
Chapter 18
Outline
Introduction of Darwinian Evolution
I. Pre-Darwinian Ideas About Evolution
A. Aristotle - movement toward ‘perfection.’
B. Jean Baptiste de Lamarck
1. Giraffe example - each generation stretches to reach higher leaves, passes traits onto offspring.
2. Problems with this:
a. Human example - tribe in ? where long necks in women are considered beautiful.
b. Rings put around neck of girls, slowly stretching the necks.
c. When this went out of fashion, women didn’t have any longer necks than before.
d. Can pass on the genes for long necks, can’t pass on traits gained from exercise or other modification of the body.
II. Ideas That Influenced Darwin
A. Combined previous ideas with this own observations made on the 5 year journey of the HMS Beagle.
B. Principles of Geology by Charles Lyell
1. Mountains, valleys, and other physical features of Earth’s surface did not originate in their present forms.
2. Developed slowly over long periods of time.
3. Earth is extremely old.
C. Artificial selection
1. Breeders can cause extreme changes in a species in just a few generations by selecting for a desired trait and breeding (artificial selection of mates) for it.
2. Dog example - find some good pictures on the internet.
3. Broccoli example:
a. All one species, Brassica oleracea.
b. Selectively breeding the wild cabbage (colewort) produced seven vegetables:
Enlarged terminal bud - cabbage
Enlarged, eatable flowers - broccoli and cauliflower
Enlarged axillary buds - brussels sprouts
Enlarged stems - kohlrabi
Eatable leaves - collard and kale
D. Thomas Malthus, a British clergyman and economist
1. Human population growth can be geometrical (2 64 68).
2. Food supply only grows arithmetically (1 62 63, or, you can’t eat your seed corn).
3. Competition for limited resources causes war, famine, disease, etc., all of which puts a break on population growth.
4. Strong and constant check on human population growth.
III. Darwinian Evolution
A. Terms
1. Evolution - beginning definition is the accumulation of inherited changes within populations over time.
2. Population - group of individuals of one species that live in the same geographic areas at the same time.
3. Species - a group of organisms, with similar structure, function, and behavior that are capable of interbreeding with one another.
a. Working definition.
b. Some arguments over what ‘species’ means, especially when defining an endangered or threatened species.
c. The definition given is good enough for the present.
4. Natural selection - better-adapted organisms are more likely to survive and become the parents of the next generation.
a. Dog example
b. Release the average chichaia into the Provo ‘wilds,’ meaning a backyard, and it will survive anywhere from ten minutes to three months, depending upon the weather. Would do OK in a warmer climate such as California. This dog breed is the result of artificial selection.
c. Release the average non-working breed of dog into the mountains of the Washach Front and, The Incredible Journey not withstanding, it’s going to starve.
d. This will be the case for most domesticated animals and plants - product of artificial selection - traits selected by humans to meet needs of humans, not the needs of the organisms for the environment.
e. Some wild species, on the other hand, are doing quite well in their changing environment - deer, coyotes, domesticated mice and rats, roaches, all do well in contact with humans.
f. Wild species that do not do well in contact with humans are becoming extinct.
B. Darwin proposed that evolution occurs by natural selection.
1. Variation
a. Individuals in a population exhibit variation.
b. Each individual has a unique combination of traits, such as color, size, ability to resist infection, etc.
c. Some traits either improve an individual’s chances of survival or do not.
d. Variation necessary for evolution by natural selection must be inherited.
2. Overproduction
a. The reproductive ability of each species has the potential to cause the population to geometrically increase over time.
b. More offspring are produced than typically survive to reproduce.
c. Female frog lays ~10,000 eggs, two of which will hatch and survive to reproductive age.
3. Limits on population growth, or a struggle for existence.
a. There is only so much food, water, light, growing space and other resources available to a population.
b. Organisms compete with one another for these limited resources.
c. More individuals than the environment can support, not all survive to reproduce.
d. Other limits on population growth are predators, disease organisms, and unfavorable weather conditions.
4. Differential reproductive success
a. Those individuals that have the most favorable combination of characteristics (those that make individuals better adapted to their environment) are more likely to survive and reproduce.
b. Offspring tend to resemble their parents - inherited traits.
c. Successful reproduction is key - best-adapted individuals produce more offspring, less-adapted individuals die prematurely or produce fewer or inferior offspring.
C. Modern synthesis/synthetic theory of evolution
1. Darwin didn’t know how traits were inherited or why there was variation in a population.
2. Once genetics introduced, able to explain.
3. Combined the principles of Mendelian inheritance with Darwin’s theory of natural selection to form a unified explanation of evolution known as the modern synthesis or the synthetic theory of evolution.
IV. Evidence Supporting Darwinian Evolution
A. Fossil record
1. Remains of life preserved in sedimentary rock
2. Remains also found in bogs, tar, amber, and ice – anything that will slow decay and protect from weathering.
3. Fossils show a progression from unicellular organisms to multicellular organisms, demonstrating that life evolved through time.
a. Able to determine what’s older.
b. Younger layers of sediment usually on top.
c. Index fossils - lots of them in only one age of rock.
d. Radioactive decay
Potassium-40 has a half-life of 1.3 billion years and is used to date rock - decays in to argon-40 - magma solidifies with potassium-40 - gas escapes liquid rock but is trapped in solid rock
Uranium-235 has a half-life of 704 million years and is used to date rock
Carbon-14 has a half-life of 5730 years - used to date the carbon remains of anything that was once living.
Try to use more than one radioisotope for dating - more accurate.
4. Fossils form only under select conditions that slow or prevent the decay process:
a. Buried in a reduced oxygen medium.
b. Remains covered quickly by a sediment of fine soil particles suspended in water - bogs, mudflats, sandbars, deltas, floodplains.
c. Remains covered quickly by windblown sand - deserts.
d. Trapped in tree sap - forested areas.
e. Volcanic eruptions - volcanic ash kills and buries all in one swipe.
f. Quick frozen - arctic areas - relatively recent, because freeze-thaw is a good way to destroy a specimen.
5. Fossil record not a random sample of past life.
a. Biased toward aquatic organisms.
b. Biased toward terrestrial organisms living in few areas conducive to fossil formation - river plains, by lakes, volcanic areas, etc.
c. Biased toward organisms with hard body parts, such as bones and shells.
d. Very few fossils found from tropical forest areas - decay quickly on the forest floor from the heat, moisture, and many scavengers.
e. Very few fossils found of organisms will all soft body parts, such as bacteria/unicellular organisms, worms, sharks (only teeth found).
f. Some rocks of certain ages are more accessible to paleontologists than are rocks of other ages - what’s eroded and how much (too little and it’s not exposed, too much as it’s gone), what’s been destroyed by volcanism, etc.
6. Book’s example of whale evolution - excited about because it’s a fairly recent discovery.
B. Biogeography
1. Biogeography - study of the past and present geographic distribution of organisms.
2. The geographic distribution of organisms affects their evolution.
a. Species on ocean islands tend to resemble species of the nearest mainland, even if the environment is different - migration from the nearest mainland.
b. Species on ocean islands do not tend to resemble species on islands with similar environments in other parts of the world - ancestors of the island species separated by distance.
c. Australia has been a separate landmass for millions of years and has distinctive organisms - isolation prevented later placental mammals to compete with monotremes and marsupials.
d. Continental drift - all landmasses were once connected in a supercontinent called Pangaea, which subsequently broke up.
e. Plate tectonics - movement of the crustal plates.
f. Species divergence based on how long ago landmasses separated - old world vs new world monkeys - S. America and Africa both have monkeys (more recently joined than N. America and Eurasia) but they are noticeably different (perihensil tails).
C. Comparative biology
1. Before molecular biology, organisms were grouped according to similarities of anatomy/structure, reproduction, feathers vs scales, etc.
a. Mammals grouped together because they all have hair/fur and feed their young with milk - includes placental, marsupial, and egg-laying species.
b. Birds grouped together because they have feathers, lay eggs, and have hollow bones - includes flightless varieties.
2. Similar features, such as milk production or feathers or forelimbs, indicates a common ancestor.
3. Homologous features - structures derived from the same structure in a common ancestor - condition known as homology.
a. Forelimb in mammals.
b. Leaves in plants - spine in the fishhook cactus and the tendrils of the garden pea are all modified leaves.
4. Convergent evolution - independent evolution of similar structures in distantly related organisms.
a. Wings of birds and bats - because flight requires the same aerodynamics, the wings of different, unrelated species look similar
b. Often the entire animal looks similar if it occupies a similar environmental niche
Heads of mule deer and kangaroos - eyes on sides, ears on top, narrow snout
Heads of T. rex or raptors and wolves - eyes forward, big teeth, prominent nostrils, long limbs
Hind limbs of raptors and emus
c. Homoplastic feature/homoplasy - structurally similar features that are evolved independently in distantly related organisms by convergent evolution.
d. Homoplasy - similarities in different species that are independently acquired.
5. Vestigial structures
a. Organs or parts of organs that are seemingly nonfunctional and degenerate, often undersized or lacking some essential part.
b. Remnants of more developed structures that were present and functional in ancestral organisms.
c. In humans, more than 100 structures are considered vestigial: coccyx (fused tailbones), third molars, muscles that move our ears.
d. Whales and pythons have vestigial hind-limb bones.
e. As structure becomes less essential for survival, can ‘put up with’ mutations cause reduced structure in that limb. Some speculate that lose of one structure can lead to gain of another structure - humans ‘exchanging’ tails and fur for larger brains.
D. Developmental biology
1. Mutations in genes that regulate the orderly sequence of events that occurs during development.
2. Example of snakes - elongation and loss of limbs are from several mutations in the Hox genes that affect expression of body patterns and limb formation.
3. Example of bird beaks - a gene involved with craniofacial skeleton development, BMP4 - when turned on early, the beak is heavier and thicker.
4. Example of vertebrate embryos
All go through a fish stage where it is hard to tell one species from another.
Evolution is a conservative process, building on what is available instead of building from scratch.
Evolution of new features often does not require the evolution of new developmental genes but instead depends on a modification in developmental genes that already exist.
All terrestrial vertebrates are thought to have evolved from fish-like ancestors; therefore, they share some of the early stages of development still found in fishes tody.
E. Comparative molecular biology
1. Genetic code is virtually universal.
2. Proteins and DNA contain a record of evolutionary change.
a. Sequence studies of protein and DNA agree with similarities in structure among living organisms and on fossil data of extinct organisms.
b. DNA sequencing to determine the order of nucleotides - divergence also indicates relatedness.
c. Cytochrome c
A part of the electron transport chain.
Not all amino acids that confer the structural and functional features of cytochrome c are free to change - few spots for silent mutations.
Silent mutations that do arise are indicators of how long two species have diverged - sort of a molecular clock.
3. Sometimes the fossil record and molecular clocks do not agree - whale relatedness
a. Fossil record indicates mesonychains as ancestors
b. Molecular phylogenetic tree indicates artiodactyls (even-toed hoofed mammals) with hippos being the most closely related
c. Mesonychains are not ancient artiodactyls
F. Experimentation
1. Guppy experiments in Venezuela and Trinidad
2. Guppies from high-predation environments mature earlier and are smaller than guppies from low-predation environments.
3. Guppies from low-predation environments grow larger and reach sexual maturity later and produce fewer, larger offspring.
a. High-predation - different kinds and numbers of fishes that prey on guppies.
b. Low-predations - only one kind of predatory fish that occasionally preys on small guppies.
4. Pools separated by waterfalls - populations can’t move upstream from waterfalls.
5. Researchers moved guppies from high-predation pools to low-predation, guppy-less pools and monitored the generations of guppies.
6. 11 years later, the decedents of the high-predation guppies resembled guppies that had always been in low-predation pools.
7. If were me, I’d then introduce lots of predators into these pools to see if the decedents switch back.
8. Other experiments, intentional or otherwise confirm.
a. Antibiotic resistance in bacteria.
b. Pesticide resistance in agricultural pests.
c. Super mice resistant to hemorrhagic and neurological poisons.
Chapter 19
Outline
Evolutionary Change in Populations
I. Population Genetics
A. Terms
1. Population - all the individuals of the same species that live in a particular place at the same time.
2. Gene pool - all the alleles for all the loci present in the population.
a. Genetic variation of the individuals of a population indicates that each individual has a different subset of the alleles in the gene pool.
3. Genotype frequency
a. Population of a particular genotype in a population.
b. 1000 individuals sampled
Genotype Number Genotype Frequency
AA 490 0.49
Aa 420 0.42
aa 90 0.09
Total 1000 1.00
4. Phenotype frequency
a. Proportion of a particular phenotype in the population.
b. 1000 individuals sampled
Phenotype Number Phenotype Frequency
Dominate 910 0.91
Recessive 90 0.09
Total 1000 1.00
c. Dominate phenotype is sum of two genotypes, AA & Aa.
5. Allele frequency
a. Proportion of a particular allele in a population.
b. Each individual is diploid, so has two alleles.
Allele Number Allele Frequency
A 1400 0.7
a 600 0.3
Total 2000 1.0
B. Hardy-Weinberg principle
1. Frequencies of alleles and genotypes do not change from generation to generation unless influenced by outside factors.
2. Genetic equilibrium - no net change in allele or genotype frequencies over time - is not undergoing evolutionary change.
3. Hardy-Weinberg principle of genetic equilibrium
a. If population is large, the process of inheritance does not by itself cause changes in allele frequencies.
b. This explains why dominate genes are not more frequent than recessive.
c. Hardy-Weinberg uses phenotype frequencies to calculate the expected genotype frequencies and allele frequencies, assuming a clear understanding of the genetic basis for the character under study.
p2 + 2pq + q2 = 1
Frequency of AA Frequency of Aa Frequency of aa All individuals in pop
d. Any population in which the distribution of genotypes conforms to the relationship p2 + 2pq + q2 = 1, whatever the absolute values for p & q may be, is at genetic equilibrium.
e. Allows biologists to calculate allele frequencies in a given population if we know the genotype frequencies, and vice versa.
f. Use this information to determine if the population is evolving.
4. Conditions for genetic equilibrium:
a. Random mating
Each individual in a population has an equal chance of mating with any individual of the opposite sex.
Mate selection must not be on the basis of genotype or any other factors that result in nonrandom mating.
b. No net mutations
No mutations that convert A into a or vice versa.
A & a frequencies must not change due to mutation
c. Large population size
Allele frequencies are more likely to change in small populations than in large populations.
d. No migration
Doesn’t mean seasonal migrations of the entire population
No exchange of alleles with other populations that might have different allele frequencies.
No migrations of individuals into or out of the populations
e. No natural selection
If natural selection is occurring, some phenotypes are favored over others.
Favored phenotypes (and their genotypes) have greater fitness, which is relative ability to make a genetic contribution to subsequent generations - allele frequencies will change.
5. Human MN blood groups
a. No medical advantage/disadvantage; no phenotype to influence mating, co-dominant (both alleles are expressed phenotypically)
b. Example of a human gene at equilibrium
Genotype Observed Expected
MM 320 313.6
MN 480 492.8
NN 200 193.6
Total 1000 1000.0
II. Genetic Variation in Populations (Microevolution)
A. Nonrandom mating changes genotype frequencies
1. When individuals select mates on the basis of a phenotype, they influence the frequencies of the corresponding genotypes.
2. Inbreeding
a. Neighbors tend to mate with neighbors
b. Increases homozygous genotypes but does not change overall allele frequency
c. Most extreme example of inbreeding is self-fertilization (plants)
Inbreeding not detrimental in some populations, but in others causes inbreeding depression, in which inbred individuals have lower fitness than those not inbred (fertility declines, high juvenile mortality)
3. Assortative mating - individual select mates on the basis of phenotype.
a. Fruit flies with low and high bristle numbers.
b. Low bristle flies were attracted to each other, as where high bristle flies
c. Example of positive assortative mating
d. Negative assortative mating - opposites attract, less common
e. Assortative mating tends to increase homozygosity in the population but does not change overall allele frequency
f. Assortative mating changes genotype frequencies only at the loci involved in mate choice, whereas inbreeding affects the entire genome.
B. Mutation increases variation within a population
1. Mutations are unpredictable - do not arrise with the ‘needs’ of the population.
2. Only involves mutations in reproductive cells - passed onto the next generation.
3. Mutations in somatic cells affect only the individual.
C. Genetic drift
1. Production of random evolutionary changes in a small population through chance.
2. Predators kill the only two individuals with a rare allele and the allele is lost to the population.
3. Larger populations may have the same frequency (percentage) of individuals carrying the rare allele, which results in more numbers of individuals carrying the allele (twenty vs two).
4. Genetic drift decreased genetic variation within a population while it tends to increase genetic differences among different populations.
5. Because of fluctuations in the environment, such as depletion in food supply or an outbreak of disease, a population may rapidly and markedly decrease from time to time - said to go through a bottleneck during which genetic drift can occur in the small population of survivors.
a. As the population recovers and increases its numbers, allele frequencies maybe quite different from allele frequencies before the decline.
b. Black Death of the 1300's - example of human bottleneck - European population decreased by 3/4 is some areas.
c. Cheetah genetic variation was greatly reduced at the end of the last Ice Age - can accept skin grafts from unrelated individuals.
6. Founder effect - when a small number of individuals establish a colony, bringing only a small fraction of the genetic variation present in the original population.
a. Finland settled about 4000 years ago and remained geographically separate from the rest of Europe and Asia.
b. Same thing happened in Iceland - isolation and bottlenecks have made them very genetically similar.
c. Amish of Pennsylvania - 200 founders - Ellis-van Creveld syndrome (six-fingered dwarfism)
D. Natural selection changes allele frequencies in a way that increases adaption
1. Operates on an organism’s phenotype
2. The phenotype represents an interaction between the environment and all the alleles in the organism’s genotype.
a. Rare for one locus to determine a phenotype, such as was seen in Mendel’s peas.
b. More common for phenotype to be polygenicly controlled.
3. Stabilizing selection
a. Associated with a population well adapted to the environment.
b. Selects against extremes - selects for intermediate or average phenotypes.
c. Human birth weight - too little and baby is underdeveloped, too big and the baby (and mother) may not survive birth.
4. Directional selection
a. If an environment changes over time, directional selection may favor phenotypes at one of the extremes
b. Over time, one phenotype gradually replaces the other.
c. Komodo dragons
Monitor lizards that became larger on the island as the larger individuals were favored.
Meanwhile, elephants on the island became smaller and smaller due to limited resources.
d. Poaching elephants
Elephants with big tusks preferentially killed - more money and less risk and less work than killing many elephants with small tusks.
Elephants in highly poached populations are more likely, now, to have small or no tusks.
Elephants in protected populations have larger tusks - aid in fights with other elephants, help in getting food (knocking down trees)
5. Disruptive selection
a. A special type of directional selection in which there is a trend in several directions rather than just one.
b. Selects against the average
c. Rare
d. Finch population on a Galapoagos island
Drought made only two food resources available, wood-boring insects and cactus fruit.
Finches with longer beaks could get at the cactus fruits.
Finches with wider beaks could strip off tree bark to expose insects.
Finches with intermediate beaks died.
3. What forces promote genetic diversity within the gene pool of a population? What forces promote changes in gene pool gene (allele) frequencies?
Outline
I. Mendel’s principles of inheritance
A. Gregor Mendel
1. Monk in Austria, published work in 1866, not recognized until 1900.
2. Performed experiments with garden pea plants, results of which became the foundation of genetics.
B. Pea plant crosses
1. Before Mendel, breeders of animals and plants knew about true-breeding stock and hybrids.
a. True-breeding stock produce off-spring that are the same, and so on
All have the same phenotype (physical appearance of an organism)
Genotype - genetic composition of an organisms - all genes may not be expressed
b. Hybrids are the result of a cross of true-breeding stock. Hybrids are similar but their off-spring are different, with mixed traits.
2. Other researchers had picked models that were not good for beginning:
a. Humans and calico cats – too complicated, generations are too long.
3. Peas are simpler -
a. Easy to grow, easy to control pollenation/breeding, several varieties commercially available, short generations.
b. Mendel selected plants with seven characteristics, two variations only.
c. Alleles - alternative forms of a gene - informational unit.
d. Flower color - white & purple; seed color – yellow & green; seed shape – smooth & wrinkled; stem height – tall & short, etc.
4. Mendel purchased seeds that were true-breeding
a. Raised them for several generations to be sure.
b. Called the P or parental generation.
5. Performed various crosses of the P generation.
a. F1 generation - first cross (1st filial [Latin, sons & daughters] generation).
b. F2 generation - cross of the F1 plants.
6. Previous thought had been that inheritance involved blending of traits.
a. Breed a tall plant with a short plant and you will get a medium-sized plant.
b. Mendel’s pea plants showed a different result - F1 plants all tall, F2 plants, 2/3 tall, 1/3 short.
II. Prediction of monohybrid crosses
A. Monohybrid crosses
1. Punnett square
2. Tall (T) & short (t) stems
3. Purple (P) & white (p) flowers
4. 3:1 ratio
5. Terms
a. Monohybrid cross - involves individuals with different alleles of a given locus
b. Locus - designates the position of a gene on the chromosome (Fig 11-5 on page 239).
c. Dominate - factor/gene expressed in F1
d. Recessive - factor/gene masked by the dominate gene when both are present.
e. Homozygous - have the same allele on homologous chromosomes (either dominate or recessive).
f. Heterozygous - have different alleles on homologous chromosomes
B. Principles of segregation and independent assortment
1. Principle of segregation - before sexual reproduction occurs, the two alleles by an individual parent must become separated (that is segregated).
a. During meiosis, homologous chromosomes (and genes on them) separate.
b. Alleles go not mix or destroy each other.
c. Recessive genes are not lost can reappear in later generations
2. Principle of independent assortment - members of any gene pair segregate from one another independently of the members of the other gene pairs.
a. Each gamete contains one allele for each locus.
b. Alleles of different loci are assorted at random with respect to each other in the gametes.
B. Test crosses
1. Guinea pigs (Fig 11-7) - want to know if a black guinea pig is homozygous or heterozygous
2. Breed with a homozygous recessive guinea pig and check the results.
3. ½ black and ½ brown - heterozygous
4. All black - probably homozygous
Why probably? Because of heterozygous have an equal change of producing gametes carrying the black or brown allele - by change, all the off-spring may have only received the dominate gene.
Example of black haired, brown-eyed Italian father; blonde, blue-eyed mother with two blonde, blue-eyed children.
C. Dihybrid crosses
1. Guinea pigs (Figure 11-8 on page 242).
2. Black, short-haired dominate; brown, long-haired recessive
3. F1 - all black, short-haired
4. F2 - ratio 9:3:3:1
Hair color and hair length separate independently
9/16 will be black, short-haired
3/16 will be black, long-haired
3/16 will be brown, short-haired
1/16 will be brown, long-haired
5. Blood type example - ABO and Rh factor
III. Gene linkage
A. Work with the fruit fly, Drosophila melanogaster.
1. Did not follow classic Mendelian genetics
2. Figure 11-11 on page 246
3. Of 2300 off-spring, expected 1/4 of off-spring to be from each independent assortment phenotype.
4. In the actual results, 83% belonged to each of the two parental classes, and 17% belonged to the two recombinant classes.
5. Determined that wing shape and body color are linked, or on the same chromosome.
6. Because they are on the same chromosome, they do not assort independently.
B. Frequency of crossing-over
1. If on the same chromosome, how do we get any recombinant phenotypes?
2. Crossing-over during meiosis
Homologous chromosomes line up - synapsis.
Enzymes break the chromosomes and reattach the pieces on the homologous chromosome.
3. Use frequency of crossing-over to determine linear order of linked genes.
Use data to determine percentage of crossing-over.
Divide number of individuals in the two recombinant classes of offspring by total number of offspring and multiply by 100
Fruit fly example: (391/2300)*100 = 17%
V locus and B locus have 17% recombination between them.
Crossing-over more likely to occur if loci are further apart on the chromosome.
Map units - 1% recombination between two loci equals a distance of 1 map unit apart.
V and B loci are 17 map units apart.
4. Fig 11-13 on page 248 - Gene mapping
IV. Sex chromosomes
A. Inheritance of sex
1. Sex determined by different factors in different species.
2. Alligators - temperature
3. Most species, genes are the most important factor.
4. Some species, specific sex chromosomes - rest called autosomes.
a. In mammals, the Y chromosome determines male sex.
b. Several genes on Y chromosome contribute to male developement.
c. Sex reversal on Y (SRY) gen is the major male-determining gene on the Y chromosome, acts as a ‘genetic switch’ that causes testes to develop in the fetus.
d. Testes produce testosterone, which causes other male characteristics to develop.
e. Some genes on X chromosome, some on autosomes.
f. Evidence suggests that X & Y chromosomes were originally a homologous pair, but the Y chromosome lost most of its genetic material. Functional genes preserved on the X chromosome.
B. X-linked genes
1. Because X & Y can’t line up for synapsis, cross-over is very rare/nonexistent.
2. Genes located on the X-chromosome have unusual heiritance patterns.
3. Used to be called ‘sex-linked genes’, because they are on a sex chromosome, but now called ‘X-linked genes’ which is more appropriate. Genes on X-chromosome are not necessarily linked to sex/sex development.
a. Color perception
b. Blood clotting
4. Figure 11-16 on page 250 - X-linked red-green color blindness
a. Normal father with carrier mother - half sons will be red-green color blind and half daughters will be carriers.
b. Color-blind father with carrier mother - half children (male and female) will be color blind and all normal daughters will be carriers.
C. Dosage compensation
1. Female mammals have potentially double-dose of X-genes from both homologous X-chromosomes.
2. Dosage compensation is a mechanism that makes equivalent the two doses in the female and the single dose in the male.
3. Dosage compensation in humans and other mammals involves the random inactivation of one/most of one of the X-chromosomes.
a. During interphase, a dark spot of chromatin is visible at the edge of the nucleus of each female mammalian cell when stained and observed under the microscope.
b. Barr body - dense metabolically inactive X chromosome.
c. 25% of the genes are expressed to some degree.
4. Calico cats - X-linked genes for black and yellow/orange fur (white different gene.
5. Sweat gland expression in humans.
6. Color-blindness - patches of color-blind cells in the retina, normal patches make up the difference.
V. Extensions of Mendelian Genetics
A. Pleiotropy - multiple affects from one gene.
1. Homozygous for recessive allele that causes cystic fibrosis produce abnormally thick mucus in many areas of the body, including respiratory, digestive, and reproductive systems.
a. Two CF parents will have CF children.
b. One CF parent and a normal parent will have all carrier children, unless the normal parent is a carrier, then 50% CF, 25% carrier, 25% non-carrier.
2. Dwarfism - dominate allele for abnormal growth of bones
a. Achondroplaisa - normal sized truck, short limbs, and slightly enlarged head.
b. 70% of all dwarfism
c. May have problems with apnea (central & obstructive) and hydrocephalus
d. Two achondroplaisic parents have 25% chance of a non-dwarf child, 50% of a dwarf child, and 25% of a double-dominate child (fatal)
B. Dominance is not always complete
1. Incomplete dominance - instances in which the heterozygote is intermediate in phenotype
a. Four o’clocks - red + white = pink in F1
b. Not ‘blending’ - red and white show up in F2, genes not ‘lost’
c. Red pigment ‘dosage’ dependant - two genes produce red, one gene produces pink, white in gene that doesn’t code for pigment.
2. Codominance - instances in which the heterozygote simultaneously expresses the pheotypes of both types of homozygotes
a. ABO blood groups
C. Multiple alleles
1. Some genes have multiple alleles
2. Rabbit coat color - sequential dominance
a. Fig 11- 19 on page 254
b. C>cch>ch>C
c. Predict cross between different rabbit coat colors
3. Some alleles of different loci may interact to produce a phenotype.
a. Chickens - two genes on different chromosomes (unlinked).
b. Rose comb [R] vs single comb [r]
c. Pea comb (P) vs single comb (p)
d. Fig 11-20 on page 254
4. Epistasis (standing on) - common type of gene interaction in which the presence of certain alleles of one locus can prevent or mask the expression of alleles of a different locus and express their own phenotype instead.
a. No novel phenotypes are produced.
b. Labrador retrievers coat color - gene for pigment and gene for depositing color in the coat.
c. Black coat (B) vs brown coat (b)
d. Expression of color/depositing color (E) vs blocking color (e, eistatic).
e. e is recessive and blocks expression of B/b.
f. Fig 11-12 on page 255.
5. Polygenic inheritance - when multiple independent pairs of genes have similar and additive effects on the same character.
a. Human skin pigment - as many as 60 loci found so far.
b. Incompletely dominate - more capital letters, darker the skin.
c. For simplicity, limit to three independent loci, A/a, B/b, C/c
d. Fig 11-22 on page 256.
Chapter 12
Outline
DNA Replication
I. General structure of DNA molecule
A. Contributors and ‘pieces’ discovered
1. Erwin Chargaff - Chargaff’s rules.
a. Reports relationships among DNA bases that provide a clue to the structure of DNA.
b. Ratios of purines (adenine, guanine) to pyrimidines (thymine, cytosine) and also adenine to thymine and guanine to cytosine were not far from 1.
2. Franklin & Wilkins
a. Rosalind Franklin - performed the X-ray diffraction on DNA crystals that showed DNA has a helical structure.
b. Maurice Wilkins was the head of the lab, received the Nobel Prize
3. Watson and Crick
a. Used information from other researchers to put together a model that reflected the data.
b. Used Franklin’s X-ray data for a helical/double helical structure and distance between the nucleotide bases and turns of the helix.
c. Used Chargaff’s data of the 1:1 ration of adenine:thymine, guanine:cystosine to determine that pairing keeps the distance between the two helixes the same. H-bonding is favored, too.
d. Determined the two helixes would need to be antiparallel to each other.
3. Meselson and Stahl
a. Demonstrated semiconservative replication.
b. Fig 12-7, page 268.
c. 15N labeled DNA in E. coli. 15N labeled DNA heavier than normal 14N DNA.
d. Isolated DNA by density gradient centrifugation for a heavy base reading.
e. Grew E. coli in normal media for one generation (20 minutes).
f. Isolated DNA - intermediate density of all 14N labeled DNA - supported semiconservative (one helix is the template for new strand) and dispersive (parental and new strands are randomly mixed during replication) replication. Conservative (both parent strands remain together, as would the new strands) would have had two bands.
g. Second generation had two bands of DNA, one intermediate and one light - supported semiconservative. Dispersive would have had one band again, but less dense.
B. Final picture
1. Double helix
2. Pairing of adenine and thymine; guanine and cystosine.
3. Replication by semiconservative replication.
II. DNA replication
A. General Process
1. Helix ‘unzipped’.
2. New strand formed by pairing with nucleotide bases.
3. Duplicated DNA has one parental strand and one new strand - two helixes total.
B. Detailed Process (Fig 12-11, page 272; Fig. 12-12, page 273)
1. Major enzyme groups (Table 12-3, page 270)
2. Helicases ‘unzip’ the helix by breaking H-bonds between nucleotide bases.
3. Single-strand binding (SSB) proteins bind to single DNA to:
a. Prevent strands from reannealing
b. Prevent hydrolysis of strands by nucleases
4. Topoisomerases produce breaks in the DNA to unwind the helix - relieve supercoiling produced by the helicases.
5. DNA primase
a. Produce a RNA primer (5 - 14 nucleotides) for the start of replication.
b. Replication proceeds from 5' to 3' of an existing polynucleotide strand.
6. DNA polymerases
a. Add nucleotides to 3' of the growing strand.
b. Nucleotides with three phosphate groups brought in.
c. Nucleotide paired with base of the template strand.
d. As nucleotide is linked, two phosphates leave - strongly exergonic reaction.
e. Polynucleotide chain is elongated by linkage of the 5' phosphate group to the 3' hydroxyl group of the sugar at the end of the existing strand - always synthesis from 5' to 3'.
7. Leading strand vs lagging strand
a. Replication happening on both sides of the replication fork.
b. One strand is replicated continuously (5' - 3' direction toward replication fork) and is called the leading strand.
c. Other strand is replicated discontinuously (5' - 3' direction away from replication fork) and is called the lagging strand.
d. Lagging strand is replicated in ‘pieces’ called Okazaki fragments.
e. Okazaki fragments replicated until come to RNA primer, DNA polymerase degrades and replaces the RNA primer with DNA
f. Starts again further up the strand toward the replication fork.
8. DNA ligase
a. Joins the DNA fragments by linking the 3' hydroxyl group with the 5' phosphate fo the DNA next to it, forming a phosphodiester linkage.
b. Also joins breaks in non-replicating DNA.
9. Number of replication forks
a. Multiple replication forks in eukaryotic cells - replication precedes faster.
b. Prokaryotic cells have circular DNA strands - one origin of replication, fewer bases.
c. Either way, forks meet and merge.
10. Telomerases cap eukaryotic chromosome ends.
a. Because eukaryotic chromosomes are linear, some DNA is lost on the end.
b. Not a problem because ends are composed of telomeres, stretches of short, simple, noncoding DNA sequences the repeat many times.
c. Human gametes 5'—TTAGGG—3'
d. Cell can divide many times before start losing essential genetic information.
e. Telomerases lengthen telomeric DNA by adding repetitive nucleotide sequences to the ends of eukaryotic chromosomes.
Active in rapidly dividing cells - germ cell lines, blood cells, skin cells, etc.
Telomere shortening implicated in cell aging and apoptosis - some cells only divide a certain number of times then die.
Cancer cells - telomeres shorten to critical lengths, telomerases kick in rather than the cells dying.
Balance between controlled immortality and cancer.
Chapter 13
Outline
Gene Expression
I. Overview of RNA
A. Difference between RNA & DNA
1. Draw structures
2. Ribose vs deoxyribose - OH group on the 2' carbon atom
3. Uracil vs thymine
4. Both joined 5' to 3'
5. Both have purines H-bonding with prymidines
B. Three Main Types of RNA
1. mRNA - single strand of RNA that carries the information for making a protein.
2. tRNA
a. Single strand of RNA that folds bac on itself to form a specific shape.
b. Each kind of tRNA bonds with only one kind of amino acid and carries it to the ribosome.
c. Because there are more kinds of tRNA molecules than there are amino acids, many amino acids are carried by two or more kinds of tRNA molecules.
3. rRNA
a. Is in a globular form.
b. Is an important part of the structure of ribosomes.
c. Has catalytic functions needed during protein synthesis.
d. rRNA made in nucleolar organizer in the nucleolus. Proteins needed for ribosomes synthesized in the cytoplasm, imported into the nucleolus, where the ribosomes are assembled.
4. Rest of the major groups are in Table 13-1, page 296. We’ll cover some of them as we go along.
II. From DNA to proteins
A. DNA genetic code
1. Triplet code
a. DNA has four bases.
b. If each base coded for one amino acid, it could only could for four amino acids.
c. Twenty amino acids commonly found in cells.
d. If each base served as a letter in a four-letter "alphabet", could code for more amino acids.
e. If each ‘word’ consisted of three ‘letters’, could ‘spell’ 64 ‘words’, more than enough to code for all the naturally occurring amino acids.
2. Codons
a. Each three base ‘word’ is called a codon.
b. Figure 13-5 on page 284.
c. More than one codon specifies certain amino acids - the code is redundant - ‘wobble’ at 3' end of the triplet.
d. Code is nearly universal - same in bacteria, yeast, and humans.
e. Some codons do not specify an amino acid, but ‘punctuation’, such as ‘start’ and ‘stop.’
3. Using the chart, ‘spell’ out examples of proteins.
a. Example one
Non-template DNA strand
5' - ATGTTTGGTGGTTTA - 5'
Template DNA strand
3' - TACAAAGGTCCAAAT - 5'
mRNA strand
5' - AUGUUUCCAGGUUUA - 3'
Codons indicated
AUG/UUU/CCA/GGU/UUA
Find codons on the chart for amino acids/instructions coded
Met (start)/Phe/Pro/Gly/Stop
b. Example two
Non-Template DNA strand
5' - ATGGTGTCACGAUGA - 3'
Template DNA strand
3' - TACCTCTGTGGTACT - 5'
mRNA strand
5' - AUGGUGUCACGAUGA - 3'
Codons indicated
AUG/GUG/UCA/CGA/UGA
Have students find codons on the chart
Met (start)/Val/Ser/Arg/Stop
c. Example three
Non-Template DNA strand
5' - ATGGGGCAGAGCGTGATTTAA - 3'
Template DNA strand
3' - TACCCCGTCTCGCACTAAATT - 5'
mRNA strand
5' - AUGGGGCAGAGCGUGAUUUAA - 3'
Codons indicated
AUG/GGG/CAG/AGC/GUG/AUU/UAA
Find codons on the chart
Met (start)/Gly/Gln/Ser/Val/Ile/Stop
B. Transcription
1. Unwinding of the DNA molecule from the histones.
a. Like in replication, must unwind and ‘unzip’ to be ‘seen.’
b. Part of gene regulation is modifying the DNA molecule so it can be exposed or not.
2. DNA-dependent RNA polymerases
a. Types of RNA polymerases
RNA polymerase I catalyzes the synthesis of several kinds of rRNA molecules that are components of the ribosome.
RNA polymerase II catalyzes the production of the protein-coding mRNA
RNA polymerase III catalyzes the synthesis of tRNA and one of the rRNA molecules.
b. Behavior
Require DNA as a template (‘DNA-dependent’ portion of the name).
Carry out synthesis in the 5' 6 3' direction - begin at the 5' end of the RNA molecule being synthesized then continue to add nucleotides at the 3' end until the molecule is complete.
Use nucleotides with three phosphate groups (like ATP, GTP), two phosphate groups come off after polymerization.
Doesn’t require a RNA primer.
3. Synthesis of mRNA
a. Initiation
Promoter - nucleotide sequence in DNA to which RNA polymerase and associated proteins initially bind.
Promoter is not transcribed (no mRNA made from it) – the RNA polymerase moves past it before beginning transcription.
Promoters slightly different for each gene - another method of control.
Promoters upstream (toward 5' end of the mRNA sequence, toward the 3' end of the template DNA) of the point where transcription will begin.
Once RNA polymerase recognizes the promoter, unwinds DNA molecule and initiates transcription.
b. Elongation
First RNA nucleotide retains its triphosphate group on the 5' end.
During elongation, each RNA nucleotide added to the 3' end loses two of the phosphate groups in an exergonic reaction.
Remaining phosphate group is incorporated into the phosphate sugar backbone.
Terminal 3' end has an exposed OH group.
c. Termination
Elongation continues until the RNA polymerase recognizes a termination squence.
This signal leads to a separation of RNA polymerase from the template DNA and the newly synthesized RNA.
Prokaryotes - termination signal causes the RNA polymerase to separate from the DNA template strand and the newly synthesized mRNA strand.
Eukaryotes - after termination signal, RNA polymerase adds nucleotides (about 10 - 35) before seperating.
4. Use examples from II.A. for transcription.
5. Mutations (Figure 13 - 20, page 299)
a. Base substitution
Involves a change in only one pair of nucleotides.
Usually result from errors in base pairing during replication.
b. Missense
Base substitutions that result in replacement of one amino acid by another.
Missense mutations have a wide range of effects.
Occurs at or near enzyme active site with a replacement by a very different amino acid (acid replacing a basic amino acid) - enzyme activity may be decreased or completely inactivated.
Replacement of a very different amino acid occurs further away from active site - enzyme may be unaffected, if folding is unaffected.
Replacement with a very similar amino acid (acid for acid), may not change anything - a silent mutation.
c. Nonsense
Base substitutions that covert an amino acid-specifying codon to a stop codon.
Chapter 18
Outline
Introduction of Darwinian Evolution
I. Pre-Darwinian Ideas About Evolution
A. Aristotle - movement toward ‘perfection.’
B. Jean Baptiste de Lamarck
1. Giraffe example - each generation stretches to reach higher leaves, passes traits onto offspring.
2. Problems with this:
a. Human example - tribe in ? where long necks in women are considered beautiful.
b. Rings put around neck of girls, slowly stretching the necks.
c. When this went out of fashion, women didn’t have any longer necks than before.
d. Can pass on the genes for long necks, can’t pass on traits gained from exercise or other modification of the body.
II. Ideas That Influenced Darwin
A. Combined previous ideas with this own observations made on the 5 year journey of the HMS Beagle.
B. Principles of Geology by Charles Lyell
1. Mountains, valleys, and other physical features of Earth’s surface did not originate in their present forms.
2. Developed slowly over long periods of time.
3. Earth is extremely old.
C. Artificial selection
1. Breeders can cause extreme changes in a species in just a few generations by selecting for a desired trait and breeding (artificial selection of mates) for it.
2. Dog example - find some good pictures on the internet.
3. Broccoli example:
a. All one species, Brassica oleracea.
b. Selectively breeding the wild cabbage (colewort) produced seven vegetables:
Enlarged terminal bud - cabbage
Enlarged, eatable flowers - broccoli and cauliflower
Enlarged axillary buds - brussels sprouts
Enlarged stems - kohlrabi
Eatable leaves - collard and kale
D. Thomas Malthus, a British clergyman and economist
1. Human population growth can be geometrical (2 64 68).
2. Food supply only grows arithmetically (1 62 63, or, you can’t eat your seed corn).
3. Competition for limited resources causes war, famine, disease, etc., all of which puts a break on population growth.
4. Strong and constant check on human population growth.
III. Darwinian Evolution
A. Terms
1. Evolution - beginning definition is the accumulation of inherited changes within populations over time.
2. Population - group of individuals of one species that live in the same geographic areas at the same time.
3. Species - a group of organisms, with similar structure, function, and behavior that are capable of interbreeding with one another.
a. Working definition.
b. Some arguments over what ‘species’ means, especially when defining an endangered or threatened species.
c. The definition given is good enough for the present.
4. Natural selection - better-adapted organisms are more likely to survive and become the parents of the next generation.
a. Dog example
b. Release the average chichaia into the Provo ‘wilds,’ meaning a backyard, and it will survive anywhere from ten minutes to three months, depending upon the weather. Would do OK in a warmer climate such as California. This dog breed is the result of artificial selection.
c. Release the average non-working breed of dog into the mountains of the Washach Front and, The Incredible Journey not withstanding, it’s going to starve.
d. This will be the case for most domesticated animals and plants - product of artificial selection - traits selected by humans to meet needs of humans, not the needs of the organisms for the environment.
e. Some wild species, on the other hand, are doing quite well in their changing environment - deer, coyotes, domesticated mice and rats, roaches, all do well in contact with humans.
f. Wild species that do not do well in contact with humans are becoming extinct.
B. Darwin proposed that evolution occurs by natural selection.
1. Variation
a. Individuals in a population exhibit variation.
b. Each individual has a unique combination of traits, such as color, size, ability to resist infection, etc.
c. Some traits either improve an individual’s chances of survival or do not.
d. Variation necessary for evolution by natural selection must be inherited.
2. Overproduction
a. The reproductive ability of each species has the potential to cause the population to geometrically increase over time.
b. More offspring are produced than typically survive to reproduce.
c. Female frog lays ~10,000 eggs, two of which will hatch and survive to reproductive age.
3. Limits on population growth, or a struggle for existence.
a. There is only so much food, water, light, growing space and other resources available to a population.
b. Organisms compete with one another for these limited resources.
c. More individuals than the environment can support, not all survive to reproduce.
d. Other limits on population growth are predators, disease organisms, and unfavorable weather conditions.
4. Differential reproductive success
a. Those individuals that have the most favorable combination of characteristics (those that make individuals better adapted to their environment) are more likely to survive and reproduce.
b. Offspring tend to resemble their parents - inherited traits.
c. Successful reproduction is key - best-adapted individuals produce more offspring, less-adapted individuals die prematurely or produce fewer or inferior offspring.
C. Modern synthesis/synthetic theory of evolution
1. Darwin didn’t know how traits were inherited or why there was variation in a population.
2. Once genetics introduced, able to explain.
3. Combined the principles of Mendelian inheritance with Darwin’s theory of natural selection to form a unified explanation of evolution known as the modern synthesis or the synthetic theory of evolution.
IV. Evidence Supporting Darwinian Evolution
A. Fossil record
1. Remains of life preserved in sedimentary rock
2. Remains also found in bogs, tar, amber, and ice – anything that will slow decay and protect from weathering.
3. Fossils show a progression from unicellular organisms to multicellular organisms, demonstrating that life evolved through time.
a. Able to determine what’s older.
b. Younger layers of sediment usually on top.
c. Index fossils - lots of them in only one age of rock.
d. Radioactive decay
Potassium-40 has a half-life of 1.3 billion years and is used to date rock - decays in to argon-40 - magma solidifies with potassium-40 - gas escapes liquid rock but is trapped in solid rock
Uranium-235 has a half-life of 704 million years and is used to date rock
Carbon-14 has a half-life of 5730 years - used to date the carbon remains of anything that was once living.
Try to use more than one radioisotope for dating - more accurate.
4. Fossils form only under select conditions that slow or prevent the decay process:
a. Buried in a reduced oxygen medium.
b. Remains covered quickly by a sediment of fine soil particles suspended in water - bogs, mudflats, sandbars, deltas, floodplains.
c. Remains covered quickly by windblown sand - deserts.
d. Trapped in tree sap - forested areas.
e. Volcanic eruptions - volcanic ash kills and buries all in one swipe.
f. Quick frozen - arctic areas - relatively recent, because freeze-thaw is a good way to destroy a specimen.
5. Fossil record not a random sample of past life.
a. Biased toward aquatic organisms.
b. Biased toward terrestrial organisms living in few areas conducive to fossil formation - river plains, by lakes, volcanic areas, etc.
c. Biased toward organisms with hard body parts, such as bones and shells.
d. Very few fossils found from tropical forest areas - decay quickly on the forest floor from the heat, moisture, and many scavengers.
e. Very few fossils found of organisms will all soft body parts, such as bacteria/unicellular organisms, worms, sharks (only teeth found).
f. Some rocks of certain ages are more accessible to paleontologists than are rocks of other ages - what’s eroded and how much (too little and it’s not exposed, too much as it’s gone), what’s been destroyed by volcanism, etc.
6. Book’s example of whale evolution - excited about because it’s a fairly recent discovery.
B. Biogeography
1. Biogeography - study of the past and present geographic distribution of organisms.
2. The geographic distribution of organisms affects their evolution.
a. Species on ocean islands tend to resemble species of the nearest mainland, even if the environment is different - migration from the nearest mainland.
b. Species on ocean islands do not tend to resemble species on islands with similar environments in other parts of the world - ancestors of the island species separated by distance.
c. Australia has been a separate landmass for millions of years and has distinctive organisms - isolation prevented later placental mammals to compete with monotremes and marsupials.
d. Continental drift - all landmasses were once connected in a supercontinent called Pangaea, which subsequently broke up.
e. Plate tectonics - movement of the crustal plates.
f. Species divergence based on how long ago landmasses separated - old world vs new world monkeys - S. America and Africa both have monkeys (more recently joined than N. America and Eurasia) but they are noticeably different (perihensil tails).
C. Comparative biology
1. Before molecular biology, organisms were grouped according to similarities of anatomy/structure, reproduction, feathers vs scales, etc.
a. Mammals grouped together because they all have hair/fur and feed their young with milk - includes placental, marsupial, and egg-laying species.
b. Birds grouped together because they have feathers, lay eggs, and have hollow bones - includes flightless varieties.
2. Similar features, such as milk production or feathers or forelimbs, indicates a common ancestor.
3. Homologous features - structures derived from the same structure in a common ancestor - condition known as homology.
a. Forelimb in mammals.
b. Leaves in plants - spine in the fishhook cactus and the tendrils of the garden pea are all modified leaves.
4. Convergent evolution - independent evolution of similar structures in distantly related organisms.
a. Wings of birds and bats - because flight requires the same aerodynamics, the wings of different, unrelated species look similar
b. Often the entire animal looks similar if it occupies a similar environmental niche
Heads of mule deer and kangaroos - eyes on sides, ears on top, narrow snout
Heads of T. rex or raptors and wolves - eyes forward, big teeth, prominent nostrils, long limbs
Hind limbs of raptors and emus
c. Homoplastic feature/homoplasy - structurally similar features that are evolved independently in distantly related organisms by convergent evolution.
d. Homoplasy - similarities in different species that are independently acquired.
5. Vestigial structures
a. Organs or parts of organs that are seemingly nonfunctional and degenerate, often undersized or lacking some essential part.
b. Remnants of more developed structures that were present and functional in ancestral organisms.
c. In humans, more than 100 structures are considered vestigial: coccyx (fused tailbones), third molars, muscles that move our ears.
d. Whales and pythons have vestigial hind-limb bones.
e. As structure becomes less essential for survival, can ‘put up with’ mutations cause reduced structure in that limb. Some speculate that lose of one structure can lead to gain of another structure - humans ‘exchanging’ tails and fur for larger brains.
D. Developmental biology
1. Mutations in genes that regulate the orderly sequence of events that occurs during development.
2. Example of snakes - elongation and loss of limbs are from several mutations in the Hox genes that affect expression of body patterns and limb formation.
3. Example of bird beaks - a gene involved with craniofacial skeleton development, BMP4 - when turned on early, the beak is heavier and thicker.
4. Example of vertebrate embryos
All go through a fish stage where it is hard to tell one species from another.
Evolution is a conservative process, building on what is available instead of building from scratch.
Evolution of new features often does not require the evolution of new developmental genes but instead depends on a modification in developmental genes that already exist.
All terrestrial vertebrates are thought to have evolved from fish-like ancestors; therefore, they share some of the early stages of development still found in fishes tody.
E. Comparative molecular biology
1. Genetic code is virtually universal.
2. Proteins and DNA contain a record of evolutionary change.
a. Sequence studies of protein and DNA agree with similarities in structure among living organisms and on fossil data of extinct organisms.
b. DNA sequencing to determine the order of nucleotides - divergence also indicates relatedness.
c. Cytochrome c
A part of the electron transport chain.
Not all amino acids that confer the structural and functional features of cytochrome c are free to change - few spots for silent mutations.
Silent mutations that do arise are indicators of how long two species have diverged - sort of a molecular clock.
3. Sometimes the fossil record and molecular clocks do not agree - whale relatedness
a. Fossil record indicates mesonychains as ancestors
b. Molecular phylogenetic tree indicates artiodactyls (even-toed hoofed mammals) with hippos being the most closely related
c. Mesonychains are not ancient artiodactyls
F. Experimentation
1. Guppy experiments in Venezuela and Trinidad
2. Guppies from high-predation environments mature earlier and are smaller than guppies from low-predation environments.
3. Guppies from low-predation environments grow larger and reach sexual maturity later and produce fewer, larger offspring.
a. High-predation - different kinds and numbers of fishes that prey on guppies.
b. Low-predations - only one kind of predatory fish that occasionally preys on small guppies.
4. Pools separated by waterfalls - populations can’t move upstream from waterfalls.
5. Researchers moved guppies from high-predation pools to low-predation, guppy-less pools and monitored the generations of guppies.
6. 11 years later, the decedents of the high-predation guppies resembled guppies that had always been in low-predation pools.
7. If were me, I’d then introduce lots of predators into these pools to see if the decedents switch back.
8. Other experiments, intentional or otherwise confirm.
a. Antibiotic resistance in bacteria.
b. Pesticide resistance in agricultural pests.
c. Super mice resistant to hemorrhagic and neurological poisons.
Chapter 19
Outline
Evolutionary Change in Populations
I. Population Genetics
A. Terms
1. Population - all the individuals of the same species that live in a particular place at the same time.
2. Gene pool - all the alleles for all the loci present in the population.
a. Genetic variation of the individuals of a population indicates that each individual has a different subset of the alleles in the gene pool.
3. Genotype frequency
a. Population of a particular genotype in a population.
b. 1000 individuals sampled
Genotype Number Genotype Frequency
AA 490 0.49
Aa 420 0.42
aa 90 0.09
Total 1000 1.00
4. Phenotype frequency
a. Proportion of a particular phenotype in the population.
b. 1000 individuals sampled
Phenotype Number Phenotype Frequency
Dominate 910 0.91
Recessive 90 0.09
Total 1000 1.00
c. Dominate phenotype is sum of two genotypes, AA & Aa.
5. Allele frequency
a. Proportion of a particular allele in a population.
b. Each individual is diploid, so has two alleles.
Allele Number Allele Frequency
A 1400 0.7
a 600 0.3
Total 2000 1.0
B. Hardy-Weinberg principle
1. Frequencies of alleles and genotypes do not change from generation to generation unless influenced by outside factors.
2. Genetic equilibrium - no net change in allele or genotype frequencies over time - is not undergoing evolutionary change.
3. Hardy-Weinberg principle of genetic equilibrium
a. If population is large, the process of inheritance does not by itself cause changes in allele frequencies.
b. This explains why dominate genes are not more frequent than recessive.
c. Hardy-Weinberg uses phenotype frequencies to calculate the expected genotype frequencies and allele frequencies, assuming a clear understanding of the genetic basis for the character under study.
p2 + 2pq + q2 = 1
Frequency of AA Frequency of Aa Frequency of aa All individuals in pop
d. Any population in which the distribution of genotypes conforms to the relationship p2 + 2pq + q2 = 1, whatever the absolute values for p & q may be, is at genetic equilibrium.
e. Allows biologists to calculate allele frequencies in a given population if we know the genotype frequencies, and vice versa.
f. Use this information to determine if the population is evolving.
4. Conditions for genetic equilibrium:
a. Random mating
Each individual in a population has an equal chance of mating with any individual of the opposite sex.
Mate selection must not be on the basis of genotype or any other factors that result in nonrandom mating.
b. No net mutations
No mutations that convert A into a or vice versa.
A & a frequencies must not change due to mutation
c. Large population size
Allele frequencies are more likely to change in small populations than in large populations.
d. No migration
Doesn’t mean seasonal migrations of the entire population
No exchange of alleles with other populations that might have different allele frequencies.
No migrations of individuals into or out of the populations
e. No natural selection
If natural selection is occurring, some phenotypes are favored over others.
Favored phenotypes (and their genotypes) have greater fitness, which is relative ability to make a genetic contribution to subsequent generations - allele frequencies will change.
5. Human MN blood groups
a. No medical advantage/disadvantage; no phenotype to influence mating, co-dominant (both alleles are expressed phenotypically)
b. Example of a human gene at equilibrium
Genotype Observed Expected
MM 320 313.6
MN 480 492.8
NN 200 193.6
Total 1000 1000.0
II. Genetic Variation in Populations (Microevolution)
A. Nonrandom mating changes genotype frequencies
1. When individuals select mates on the basis of a phenotype, they influence the frequencies of the corresponding genotypes.
2. Inbreeding
a. Neighbors tend to mate with neighbors
b. Increases homozygous genotypes but does not change overall allele frequency
c. Most extreme example of inbreeding is self-fertilization (plants)
Inbreeding not detrimental in some populations, but in others causes inbreeding depression, in which inbred individuals have lower fitness than those not inbred (fertility declines, high juvenile mortality)
3. Assortative mating - individual select mates on the basis of phenotype.
a. Fruit flies with low and high bristle numbers.
b. Low bristle flies were attracted to each other, as where high bristle flies
c. Example of positive assortative mating
d. Negative assortative mating - opposites attract, less common
e. Assortative mating tends to increase homozygosity in the population but does not change overall allele frequency
f. Assortative mating changes genotype frequencies only at the loci involved in mate choice, whereas inbreeding affects the entire genome.
B. Mutation increases variation within a population
1. Mutations are unpredictable - do not arrise with the ‘needs’ of the population.
2. Only involves mutations in reproductive cells - passed onto the next generation.
3. Mutations in somatic cells affect only the individual.
C. Genetic drift
1. Production of random evolutionary changes in a small population through chance.
2. Predators kill the only two individuals with a rare allele and the allele is lost to the population.
3. Larger populations may have the same frequency (percentage) of individuals carrying the rare allele, which results in more numbers of individuals carrying the allele (twenty vs two).
4. Genetic drift decreased genetic variation within a population while it tends to increase genetic differences among different populations.
5. Because of fluctuations in the environment, such as depletion in food supply or an outbreak of disease, a population may rapidly and markedly decrease from time to time - said to go through a bottleneck during which genetic drift can occur in the small population of survivors.
a. As the population recovers and increases its numbers, allele frequencies maybe quite different from allele frequencies before the decline.
b. Black Death of the 1300's - example of human bottleneck - European population decreased by 3/4 is some areas.
c. Cheetah genetic variation was greatly reduced at the end of the last Ice Age - can accept skin grafts from unrelated individuals.
6. Founder effect - when a small number of individuals establish a colony, bringing only a small fraction of the genetic variation present in the original population.
a. Finland settled about 4000 years ago and remained geographically separate from the rest of Europe and Asia.
b. Same thing happened in Iceland - isolation and bottlenecks have made them very genetically similar.
c. Amish of Pennsylvania - 200 founders - Ellis-van Creveld syndrome (six-fingered dwarfism)
D. Natural selection changes allele frequencies in a way that increases adaption
1. Operates on an organism’s phenotype
2. The phenotype represents an interaction between the environment and all the alleles in the organism’s genotype.
a. Rare for one locus to determine a phenotype, such as was seen in Mendel’s peas.
b. More common for phenotype to be polygenicly controlled.
3. Stabilizing selection
a. Associated with a population well adapted to the environment.
b. Selects against extremes - selects for intermediate or average phenotypes.
c. Human birth weight - too little and baby is underdeveloped, too big and the baby (and mother) may not survive birth.
4. Directional selection
a. If an environment changes over time, directional selection may favor phenotypes at one of the extremes
b. Over time, one phenotype gradually replaces the other.
c. Komodo dragons
Monitor lizards that became larger on the island as the larger individuals were favored.
Meanwhile, elephants on the island became smaller and smaller due to limited resources.
d. Poaching elephants
Elephants with big tusks preferentially killed - more money and less risk and less work than killing many elephants with small tusks.
Elephants in highly poached populations are more likely, now, to have small or no tusks.
Elephants in protected populations have larger tusks - aid in fights with other elephants, help in getting food (knocking down trees)
5. Disruptive selection
a. A special type of directional selection in which there is a trend in several directions rather than just one.
b. Selects against the average
c. Rare
d. Finch population on a Galapoagos island
Drought made only two food resources available, wood-boring insects and cactus fruit.
Finches with longer beaks could get at the cactus fruits.
Finches with wider beaks could strip off tree bark to expose insects.
Finches with intermediate beaks died.
3. What forces promote genetic diversity within the gene pool of a population? What forces promote changes in gene pool gene (allele) frequencies?
Tuesday, October 20, 2009
Tuesday, October 13, 2009
Lecture Notes for Chapter 7 - 10
Chapter 7 Outline
Energy & Metabolism
1. Matter & Energy
A. Terms:
Matter is anything that has mass and takes up space.
Energy is the capacity to do work, which is any change in the state or motion of matter.
E=mc2 - Matter and energy are interchangable
B. Types of energy
Potential energy is the capacity to do work as a result of position or state.
Kinetic energy is the energy of motion.
Chemical energy is a type of potential energy - stored in chemical bonds, important to organisms.
2. Laws of Thermodynamics
A. The first law of thermodynamics:
Energy cannot be created or destroyed, although it can be transferred or converted from one form to another, including conversions between matter and energy.
Organisms cannot create energy–must capture it from the surroundings.
B. The second law of thermodynamics:
When energy is converted from one form to another, some usable energy–that is, energy available to do work–is converted into heat that disperses into the surroundings.
Heat is the kinetic energy of randomly moving particles.
Unlike heat energy, which flows from an object with a higher temperature to one of lower temperature, this random motion cannot do work.
Total energy is not decreasing, but total usable energy is decreasing
Entropy (S) - a measure of the less-usable energy which is disordered or random
Usable energy has low entropy
Disorganized energy, such as heat, has high entropy
Organisms maintain high level of organization (low entropy) by importing low entropy energy sources
3. Energy & Metabolism
A. Terms
Metabolism - the sum of all the chemical activities taking place in an aroganism
Anabolism - various pathways that make more complex chemicals from simpler chemicals
Amino acids to dipeptids to proteins
Monosaccharides to polysaccharides to starch
Overall energy requirements - increasing order
3. Catabolism - various pathways that break down more complex chemicals
into simpler ones
Proteins to amino acids
Starch to monosaccharides (glucose)
Overall energy release - decreasing order
4. Enthalpy (H)
Total potential energy of the system
Bond Energy - energy required to break that bond
Total bond energy is equivalent to enthalpy (H)
5. Free energy/Gibbs free energy (G)
Amount of energy available to do work under the conditions of a biochemical reaction
Only kind of energy that can do cell work
Aspect of thermodynamics of greatest interest to biologists
6. G = H - TS or Free energy = Enthalpy (total potential energy) - T (absolute temperature in Kelvins) * S (entropy)
If entropy 0, free energy (G) = total potential energy (H)
As entropy increases, free energy decreases
As temperature increases, entropy increases
Measured in terms of change between initial state before a reaction and end state after a reaction
ΔG = ΔH -TΔS
B. Exergonic reactions
Releases energy
Spontaneous or ‘downhill’ reaction - from higher to lower free energy
ΔG (free energy) is a negative number
Spontaneous does not equal instantaneous - some happen very slowly
Some require activation energy to get started
Diffusion is a exergonic reaction
C. Endergonic reactions
Consumes energy/energy requiring
An ‘uphill’ reaction - from lower to higher free energy
Gain of free energy or ΔG (free energy) is a positive number
Does not happen in isolation - energy must be supplied by the surroundings
D. Free-energy changes depend on the concentrations of reactants and products
In biochemistry, little intrinsic free-energy difference between reactants and products
A W B
Dynamic equilibrium - rate of reverse reaction equals the rate of forward reaction
Increase initial concentration of A, force reaction to the right
Decrease the concentration of B as made, force reaction to the right
Visa versa
Cell reactions virtually never at equilibrium
E. ATP
Energy currency of the cell
Holds readily available energy for very short periods of time
Links exergonic and endergonic reactions (Fig 7-6)
Hydrolysis of ATP to ADP is exergonic - high energy because has a large -ΔG number
Phosphorylation reactions - example of glucose to sucrose (page 158)
Cannot be stored for very long
F. NAD+
Redox reactions - oxidation (lose of electrons) and reductions (gain of electrons) happens simultaneously
Happen in a series in the cells
Transfer of an electron is a transfer of energy
Not easy to remove an electron from a covalent compound - easier to transfer hydrogen (electron & proton)
Electron (either alone or part of hydrogen) transfers its energy (part of energy of chemical bond coming from) to acceptor
Loses energy with each transfer
NAD+ (nicotinamide adenine dinucleotide) - one of most frequently encountered acceptor molecules
Basic reaction (page 159)
Energy transferred to NADH (reduced form) from X when H is removed
Energy transferred to new X when NADH transfers H and is oxidized to NAD+
Specific reactions (Chapter 8)
9. Other electron acceptors:
NADP+ (nicotinamide adenine dinucleotide phosphate) - not involved in ATP synthesis, more in photosynthesis
FAD (flavin adenine dinucleotide)
Cytochromes - proteins that contain iron, which accepts the electron (more in Chapter 8)
3. Enzymes
A. Enzyme is a biological/organic catalyst - increases the speed of a chemical reaction without being consumed by the reaction.
All reactions have a required energy of activation (EA) or activation enery
- energy required to break the existing bonds
Molecules with relatively high kinetic energy are likely to react to form product - Flash point
Even an strongly exergonic reaction may be prevented from proceeding by the activation energy required to begin
Enzymes lower the activation energy of a reaction - speed up reaction rates
Doesn’t change free energy - can promote only a reaction that would proceed without it
Reactants and product reach equilibrium, no catalyst can cause a reaction to proceed in a thermodynamically unfavorable direction or can influence the final concentrations
B. How acts as a catalyst
Forms an unstable enzyme-substrate complex
Product releases when enzyme-substrate breaks up
Enzyme free to form another enzyme-substrate complex
Enzyme contains one or more active sites - regions to which the substrate binds to form ES complex
Grooves or cavities formed by amino acid side chains, usually close to the surface
Induced fit
Shape of enzyme not exactly complementary to the substrate
Binding of substrate induces a change in the shape of the enzyme and the substrate
Bonds in substrate may be distorted
Proximity and orientation of the reactants and strains in chemical bonds facilitate breakage of old bonds and formation of new ones
C. Enzymes are specific
Because shape of the active site is closely related to the shape of substrate, most enzymes are highly specific
Some catalyze reactions with only one substrate
Urease - decomposes urea to ammonia and carbon diooxide - no other substrate
Sucrase splits only sucrose
3. Few others catalyze reactions with a certain type of bond
Lipase - splits ester linkages connecting the glycerol and fatty acids of a wide variety of fats
D. CofactorsSome enzymes are only proteins
Others have two components: a protein called an apoenzyme and an additional chemical component called a cofactor
Apoenzyme and cofactor must be combined to function
Cofactor may be organic or inorganic
Inorganic can be trace metals, such as iron, copper, zinc, manganese
Organic are nonpolypeptides, usually carrier molecules for electron transfer, such as NADH, NADPH, and FADH2
ATP functions as a cofactor in phosphorylation reactions
Coenzyme A - transfers groups derived from organic acids - will discuss more in next chapter
Vitamins - cofactors or parts of cofactors the organism can’t manufacture by self
E. Optimal conditions
1. Each enzyme has an optimal temperature
Temperature too low - enzymatic reaction takes place slowly or not at all
Temperature too high - enzyme bonds responsible for secondary, tertiary and quaternary structures are broken; protein denatures; enzyme permanently inactivated as new shape is formed
Heat kills for this reason
Some organisms operate outside 35 - 40C human optimal range
Enzymes from organisms feeding on whale carcasses - cold water detergents
Enzymes from organisms living in hot pools, such as in Yellowstone - hot applications, such as PCR enzymes
2. Each enzyme has an optimal pH
Most enzymes are active over a narrow pH range, have optimal pH in which the reaction proceeds fastest
pH affects ionization of the amino acid side chains, etc.
Buffers minimize change in pH, help maintain optimal pH
Lysosome enzymes have optimal pH at lower pH than that of cell
Pepsin - protein splitter secreted by stomach - optimal pH of 2
Trypsin - protein splitter secreted by pancreas - optimal pH found in slightly basic environment of small intestine.
F. Regulation of enzymes
1. Cell can regulate pH, temperature, and enzyme and substrate concentration
2. Feedback inhibition
In a series of reactions, the end product may inhibit the first enzyme in the series
3. Reversible inhibition
Most enzyme can be inhibited by chemical agents
Reversible inhibition occurs when an inhibitor forms weak chemical bonds with the enzyme
Competitive inhibition - competes with the normal substrate for binding to the active site of the enzyme (Fig 7-17, page 167)
Noncompetitive inhibition - inhibitor binds with the enzyme at a site other than the active site
4. Allosteric sites and allosteric regulators - form of noncompetitive inhibition
Some enzymes have a site other than the active site, called an allosteric site
Substrate binds to allosteric site, changes the shape of the active site, affects enzyme activity
Allosteric activators - result in an enzyme with a functional active site
Allosteric inhibitors - result in an enzyme with a nonfunctional active site
Cell signaling examples - IP3 binds to calcium channels (Fig 6-9, page 144) to activate, cyclic AMP-dependant protein kinase (Fig 7-16, page 166) is inhibited by an allosteric inhibitor until inhibitor is removed (inhibited) by cAMP
5. Irreversible inhibition
An inhibitor permanently inactivates or destroys an enzyme when inhibitor combines with one of the enzyme’s functional groups, either at the active site or elsewhere
Many poisons are examples of irreversible inhibition - cyanide irreversibly inhibits action of cytochrome oxidase (Chapter 8) in mitochondria
Some drugs are irreversible inhibitors - penicillin irreversibly inhibits bacterial enzyme transpeptidase - establishes linkages in cell wall, cell wall ‘leaks’
Humans don’t produce cell walls, usually not affected by penicillin (except allergies)
Bacteria have fought back by producing penicillinase
Chapter 8 Outline
1. Stages of cellular respiration, terminating in aerobic respiration
A. Need to know’s
Table 8-1, page 173
Fig 8-2, page 173
Fig 8-4, pages 176 - 177
Fig 8-5, page 178
Fig 8-7, page 180
Fig 8-10, page 186
Table 8-2, page 187
Reactants & products
Enzymes
B. Overall significance or ‘purpose’ of cellular respiration
1. Cellular respiration - the name for some of the catabolic processes that convert the energy in the chemical bonds of nutrients to chemical energy stored in ATP
2. Cellular respiration may be aerobic or anaerobic.
3. Aerobic respiration requires oxygen.
4. Anaerobic pathways do not require oxygen
a. Anaerobic respiration
b. Fermentation
2. Aerobic respiration - four stages
A. Glycolysis
Fig 8-4, pages 176 - 177
B. Formation of acetyl coenzyme A
Fig 8-5, page 178
C. Citric acid cycle/Krebs Cycle
Fig 8-7, page 180
D. Electron transport & chemiosmosis
Fig 8-10, page 186
E. Two types of phosporylation:
1. Substrate-level phosphorylation: when a phosphate group is transferred to ADP from a phophorylated intermediate. Takes place during gycolysis in the cytosol and in the Krebs cycle in mitochondria.
2. Oxidative phosphorylation: production of ATP using energy derived from the transfer of electrons in the electron transport system - occurs only by chemiosmosis. Occurs in the matrix of mitochondria.
3. Anaerobic respiration
A. Table 8-2, page 187
B. Nitrate (NO3 -) or sulfate (SO4 2-) are the terminal electron acceptors instead of oxygen
C. Nitrogen cycle:
C6H12O6 + KNO3 6CO2 + 6H2O + 12 KNO2 + energy (in bonds of ATP)
potassium nitrate potassium nitrite
4. Fermentation
A. Fig 8-13, page 187
Chapter 9 Outline
1. Physical properties of light
A. Wavelength
1. Visible light represents a very small portion of a vast, continuous range of radiation called the electromagnetic spectrum.
2. All radiation in the electromagnetic spectrum travel in waves.
3. A wavelength is the distance between one wave peak and the next.
4. Fig. 9-1
a. Gamma rays have the shortest wavelength (fractions of nm) and TV and radio waves have the longest (measured in kilometers).
b. Visible spectrum or visible light is from 380 - 760 nm.
B. Photons
1. Light has both wave and particle properties.
2. Particles of light are called photons.
3. Photons have more energy when they have shorter wavelengths.
4. Photosynthesis uses the energy found in visible light.
2. Photosynthesis - General
A. Photosynthesis
1. Biological process that captures light energy and transforms it into the chemical energy of organic molecules (e.g. carbohydrates), which are manufactured from carbon dioxide and water.
2. Important to a plant because it generates energy and organic building blocks.
a. Plant uses energy to form ATP and NAPH.
b. Because ATP and NADPH are unstable, they are converted into more stable energy-storing molecules, such as glucose.
c. Glucose may then be stored as a part of sucrose, starch, etc.
d. ATP also fuels anabolic reactions that produce carbohydrates, proteins, fats, etc, that become part of the plant’s structure.
3. Important to other organisms because other organisms use energy-storing molecules and organic chemicals generated by plants.
a. Plants are autotrophs (photoautotrophs) because the chemical energy of ATP and NADPH then drives carbon fixation, the anabolic pathway in which stable organic molecules are synthesized from CO2 and water.
b. Chemoheterotrophs
1. Most animals, fungi, and most bacteria.
2. Chemotrophs because they obtain energy from chemicals.
3. Heterotrophs because they cannon fix carbon – use organic molecules produced by other organisms as the building blocks from which they synthesize the carbon compounds they need.
4. Photoheterotrophs - nonsulfur purple bacteria can use light energy but unable to carry out carbon-fixation and so need organic molecules from other organisms.
5. Chemoautotrophs - use oxidation of high energy, reduced compounds to obtain energy for carbon fixation.
B. Leaf structure
1. Mesophyll - a layer in the leaf with many air spaces and a very high concentration of water vapor.
2. Chloroplasts mainly found in cells of the mesophyll.
3. Interior of the leaf exchanges gasses with the outside through microscopic pores called stomata.
C. Chloroplast structure
1. Enclosed by outer and inner membranes.
2. Inner membrane encloses a fluid-filled region called the stroma - contains most of the enzymes for carbohydrate synthesis.
3. Suspended in the stroma is a third system of membranes that forms an interconnected set of flat, disclike sacs called thylakoids.
4. Thylakoid membrane encloses a fluid-filled interior space called the thylakoid lumen.
5. Thylakoids can be arranged in stacks called grana.
3. Light-dependent reactions
A. Take place in thylakoids of the choroplast
B. Noncyclic electron transport (Fig. 9-11 on page 199)
1. Explain photosystems I & II
a. Pigments - substances that absorb visible light.
1. Chlorophyll
The main pigment of photosynthesis.
Absorbs light mainly in the blue (422 - 492 nm) and red (647 - 760 nm).
Comes in two main forms, a and b.
Chlorophyll a initiates the light-dependant reactions of photosynthesis.
Chlorophyll b is an accessory pigment that helps absorb light.
2. Carotenoids
Yellow and orange pigments.
Absorb light in wavelengths other than those absorbed by chlorophyll.
Pass energy onto chlorophyll a.
b. Antenna complexes - chlorophyll a and b and accessory pigment molecules are organized with pigment-binding proteins in the thylakoid membrane into units called antenna complexes.
c. Each antenna complex absorbs light energy and transfers it to the reaction center.
1. P700 - Photosystem I reaction center consists of a pair of chlorophyll a molecules with an absorption peak at 700 nm.
2. P680 - Photosystem II reaction center consists of a pair of chlorophyll a molecules with an absorption peak at 680 nm.
2. Absorption of the light energy
a. Structure of chlorophyll
A long side chain that anchors the molecule in the membrane of the thylakoid.
Porphyrin ring made up of joined smaller rings (composed of carbon and nitrogen atoms) and an atom of magnesium in the center of the ring
b. Chlorophyll in the reaction center absorbs light energy passed to it from the antenna complex.
c. Light energy causes excitation of an electron in the magnesium atom (Mg).
d. Excited electron has more energy than it had before.
e. Energy can be released in two ways:
As light if the electron drops back to its original orbit.
It can be removed to an electron transport chain.
In chlorophyll, excited electron is removed to an electron transport chain.
2. Go over flow of electrons through photosystems I and II.
3. Go over products produced (look in other books - does Fig. 9-11 have a mistake in showing ATP synthesis? - does - ATP only generated by ATP synthase by chemiosmosis)
C. Cyclic electron transport (modify Fig 9-11)
1. Go over flow of electrons through photosystem I and reduction of NADPH to restore a electron to P700.
2. Some energy is used to pump H+ ions into the thylakoid lumen.
3. Energy from H+ gradient used to produce ATP.
4. No NADPH (required for carbon fixation) produced, no H2O split, and O2 is not generated.
5. Possible reasons for cyclic electron transport:
a. Occurs when too little NADP+ to accept electrons from ferredoxin.
b May help maintain the optimal ration of ATP to NADPH required for carbon fixation.
c May provide extra ATP for ATP-requiring processes in chloroplasts.
D. ATP synthesis (Fig 9-13 on page 201)
a. Explain how proton gradient is established across the thyakoid membrane.
b. Go over ATP synthesis by ATP synthase using the proton gradient (chemiosmosis).
4. Carbon fixation reactions/The Calvin cycle
A. Take place in the stoma of the chloroplast
B. Most plant use the Calvin cycle to fix carbon
1. Also known as the C3 pathway because the product of the initial carbon fixation reaction is a three-carbon compound, phosphoglycerate (PGA).
2. Plants that initially fix carbon in this way are called C3 plants.
C. The Calvin cycle (Fig 9-14 on page 203)
1. Summarize the three phases (CO2 uptake, Carbon reduction phase, and RuBP regeneration phase).
2. Indicate the roles of ATP and NADPH in this process.
5. Other carbon fixation pathways
A. Photorespiration
1. During hot temperatures, C3 plants balance need for CO2 with need to conserve water.
2. On hot dry days, leaves close stomata to conserve water.
3. Photosynthesis rapidly uses up the CO2 remaining the leaf - O2 accumulates in the chloroplasts.
4. CO2 and O2 compete for the active site of rubisco, which can act as either a carboxylase or an oxygenase - reaction can go either way.
5. Some intermediates are degraded to CO2 and H2O
a. Does not produce ATP
b. Removes intermediates from Calvin cycle
c. Reduces the photosynthetic efficiency
6. Called photorespiration because
a. It occurs in the presence of light
b. Requires oxygen
c. Produces CO2 and H2O (byproducts of aerobic respiration).
7. Many plants that live in hot, dry environments have adaptions that facilitate carbon fixation.
B. C4 pathway
1. C4 pathway efficiently fixes CO2 at low concentrations.
a. Called C4 because the product of the initial carbon fixation reaction is a four carbon compound, oxaloacetate (remember from Citric acid cycle).
b. C4 cycle used in conjunction with C3/Calvin cycle - separates the initial carbon fixation step from the rest of the Calvin cycle.
c. Plants that use the C4 cycle are called C4 plants.
2. Fig. 9-15 on page 205 - location of various cycles in C3 vs C4 plants.
3. Fig. 9-16 on page 206 to show interaction of the C3 and C4 pathways.
4. Because C4 pathway captures CO2 and provides it to the bundle sheath cells so efficiently, CO2 concentration within the bundle sheath cells is about 10 - 60 times as great as its concentration in the mesophyll cells of plants having only the C3 pathway - photorespiration is negligible.
C. CAM pathway
1. Plants living in very dry, or xeric (desert) conditions have special adaptions.
2. One is a carbon fixation pathway called the crassulacean acid metabolism (CAM) pathway.
a. Name comes from the stonecrop plant family (Crassulaceae).
b. Pathway evolved independently in other plant families.
3. Unlike most plants, open stomata at night.
a. Admit CO2.
b. Prevents water lose.
4. Use the enzyme PEP carboxylase to fix CO2 - forming oxaloacetate.
5. Oxaloacetate converted to malate.
6. Malate is stored in cell vacuoles.
7. During day, when stomata are closed, CO2 is removed from malate by decarboxylation.
8. CO2 is now available for use in the Calvin/C3 cycle.
D. Differences between C4 and CAM pathways.
1. C4 pathway - C3 and C4 pathways occur in different parts of the leaf.
2. CAM pathway - C3 and CAM pathways occur at different times in the leaf (day vs night).
3. Both maintain high levels of CO2 for use in the Calvin cycle to prevent photorespiration while preventing water lose.
Chapter 10 Outline
I. Organization of Eukaryotic Cell DNA (Fig. 10-4 on page 214)
A. DNA double helix - basic structure
1. Draw structure of a few connected nucleotides
2. Draw second, paired strand for double helix
3. In this form for replication and transcription
4. Genes
a. The term ‘gene’ has changed as we have gained understanding.
b. Always centered on being an informational unit.
May contribute to what we can see - eye color, hair color, height (polygenic), etc.
May be involved in regulation - regulator enzyme or regulatory molecule production.
May be involved in enzyme production, which is involved in protein, lipid, carbohydrate production - subunit or whole enzyme.
May be involved in structural protein production - subunit or whole protein.
B. Nucleosomes
1. DNA double helix very long - human sperm contains ~3x109 base pairs - 1 m long. Fits into a nucleus with a diameter of 10um.
2. Reasons for packaging DNA
a. Fit
b. Gene regulation
3. Packaging of DNA
a. Histones
Proteins that have a positive charge - high proportion of amino acids with basic side chains.
DNA has a negative charge because of the phosphate groups.
Histones and DNA associate to form structures called nucleosomes.
b. Nucleosomes
Fundamental unit of each nucleosome - beadlike structure with 146 base pairs of DNA wrapped around a disc-shaped core of eight histone molecules.
Histone molecules consist of two each of four different histone types.
Nucleosomes function like spools, preventing DNA from tangling.
Histones function in gene regulation - turned on or off.
Wrapping of DNA into nucleosomes represents the first level of
chromosome structure.
C. Packed nuclosomes
1. Another, fifth type of histone, histone H1, associates with the linker DNA.
2. Packs adjacent nucleosomes together to form a compacted 30-nm chromatin fiber.
D. Extended chromatin
1. Chromatin fibers form large, coiled loops held together by scaffolding proteins.
E. Chromosomes
1. Coiled loops interact to form the condensed chromatin in chromosomes.
2. Group of proteins called condensin.
Binds to DNA and wraps it into coiled loops that are compacted into a nitotic or meiotic chromosome.
DNA safely packaged for transport, so to speak.
II. Cell Cycle of an Eukaryotic Cell
A. Stages through which a cell passes from one cell division to the next are collectively referred to as the cell cycle.
1. Timing varies widely.
2. Nerve cells - years
3. Actively growing animal and plant cells - 8 - 20 hours.
B. Interphase - Time when no cell division is occurring - most of cell life.
1. G1
a. First gap phase
b. Growth and normal metabolism takes place
c. Typically longest phase
d. Cells that are not dividing usually become arrested in this part of the cell cycle and are said to be in a state called G0
e. Toward the end of G1, synthesis of proteins needed to initiate cells division and DNA sysnthesis
2. S
a. Synthesis phase
b. Chromosome duplication
DNA replication
Histone protein synthesis
3. G2
a. Second gap phase
b. Usually shorter than G1.
c. Synthesis of proteins needed for cell division.
C. M phase - Time when the cell is dividing.
1. Mitosis or Meiosis
a. Nuclear division
b. Insures that the correct number and kind of chromosomes goes to each new nucleus.
2. Cytokinesis
a. Division of the cell cytoplasm between two cells.
III. Mitosis (Fig 10-6, pages 216 - 217)
A. Nuclear division that produces two nuclei containing chromosomes identical to the parental nucleus
B. Interphase
1. Chromosomes are ‘unpacked’ into chromotin.
2. Nucleolus
3. Nuclear envelope
C. Prophase
1. Chromosome compaction - chromatin can be distributed to the daughter cells with less likelihood of tangling.
a. Sister chromatids - contain identical, double-stranded DNA sequences.
b. Each chromatid contains a constricted region called the centromere where sister chromatids are associated
c. Sister chromatids are physically linked by a ring-shaped protein complex called cohesion.
2. Kinetochore - multiprotein complex attached to centromere to which microtubles can bind.
3. Mitotic spindle develops
a. Structure that separates the duplicated chromosomes during anaphase.
b. Made up of microtubules, motor proteins, and controlled by variety of signaling molecules.
c. Microtubule-organizing center
Found in both plant and animal cells at the poles of the dividing cell
Animal cells have a pair of centrioles in the middle of each microtubule-organizing center
Centrioles surrounded by fibrils that make up the pericentriolar material
Late in propase, microtubules radiate from the pericentriolar material - called asters
Two asters migrate to two poles of the mitotic spindle
D. Prometaphase
1. Begins when nuclear envelope breaks up - sequestered for later use.
2. Nucleolus shrinks and usually disappears
3. Mitotic spindle completely assembled.
4. Duplicate chromosomes are scattered through out the nuclear region.
5. Spindle microtubules grow and shrink as they move towardd the center of the cell in a ‘search and capture’ process.
a. Microtubule comes near a kinetochore it is ‘captured’ by the kinetochore - kinetochore microtubles.
b. Move toward cell’s equator.
c. Sister chromatids kinetochore becomes attached to spindle from other pole.
6. Cohesins dissociate from sister chromatid arms but remain in the vicinity fo the centromere.
E. Metaphase
1. All cell’s chromosomes align at the cell’s midplane or metaphase plate.
2. Microtubules not connected to kinetochores are called polar microtubules or non-kinetochore microtubules - extend from each pole and overlap at equatorial region.
3. Kinetochore microtubules - extend from each pole to a kinetochore.
4. Each chromatid is completely condensed and easy to see - cells generally checked for karyotype (chromosome make up) at this stage if chromosome abnormalities are suspected.
5. Remaining cohesions dissociate from centromere.
F. Anaphase
1. Sister chromatids separate - now called chromosomes.
2. Chromosomes move to separate poles, using the microtubules as tracks.
Kinetochore lead way, arms trailing.
Micortubules depolymerize to shorten.
Polar microtubules slide against each other where they overlap at the poles, lengthening the spindle and pushing the poles apart.
3. Anaphase ends when all chromosomes reach poles.
G. Telophase
1. Arrival of the chromosomes at the poles.
2. Return of interphase nuclear conditions:
a. Chromosomes decondense by partially uncoiling.
b. New nuclear envelope forms around each set of chromosomes.
c. Spindle microtubules disappear.
d. Nucleoli reorganize.
IV. Cytokinesis
A. Division of cytoplasm to yeild two daughter cells.
1. Usually overlaps mitosis, beginning during telophase.
B. Animals & fungi
1. Actomyosin contractile ring attached to the plasma membrane encircles the cell in the equatorial region, at right angles to the spindle.
2. Contractile ring is an association between actin and myosin filaments.
3. Ring contracts, producing an cleavage furrow that gradually deepens and eventually separates the cytoplasm into two daughter cells.
B. Plants
1. Formation of a cell plate in the equatorial region.
2. Begins as a line of vesicles originating in the Golgi complex.
a. Contain materials to contruct both a primary cell wall and a middle lamella that cements the primary cell walls together.
b. Vesicles fuse to form plasma membrane of each daughter cell.
V. Meiosis (Fig. 10-13, pages 226 - 227)
A. Diploid vs Haploid
1. Diploid - two sets of each chromosome, one set from each parent.
a. Somatic cells - body cells.
b. Homologous chromosomes - carry information about the same trait - redundant system.
2. Haploid - one of each chromosome
a. Gamete formation for sexual reproduction.
b. Gametes fuse to form a zygote - return to diploid.
B. Meiosis I
1. Prophase I
a. Each duplicated chromosome (duplicated in interphase) consists of two chromatids, linked by cohsisn.
b. Synapsis
While chromatids are still elongated and thin, homologous chromosomes come to lie lengthwise side by side - synapsis (fastening together).
Results in two homologous pairs - association of four chromatids called a tetrad.
One homologous pair is called the maternal homologue, the other the paternal homologue.
Synaptonemal complex - proteinous structure holds homologous chromosomes together.
Crossing-over - enzymes break and rejoin DNA molecules, allowing paired homologous chromosomes to exchange genetic material.
Crossing-over results in genetic recombination.
c. Spindle forms.
d. Centrioles move to each pole.
e. Nuclear envelope disappears.
f. Centromeres and kinetochores of the homologous chromosomes become separated from one another - held together only where crossing-over had occurred
Called chiasmata.
Cohesions hold homologous chromosomes together after synaptonemal complex has disassembled.
2. Metaphase I
a. Tetrads align as midplate.
b. In contrast to mitosis, both sister kinetochores of one duplicated chromosome are attached to same pole.
3. Anaphase I
a. Paired homologous chromosomes separate and move toward opposite poles.
b. Each cell receives a random combination of maternal and paternal chromosomes, but only one member of each homologous pair is present at each pole.
c. Sister chromatids remain united at their centromers, unlike in mitosis.
4. Telophase I
a. Chromatids generally decondense somewhat, nuclear envelope may reform, and cytokinesis may take place.
b. Each nucleus contains the haploid number of chromosomes, but each chromsome is a duplicated chromosome (pair of chromatids).
c. A short interphase-like stage usually follows called interkinesis.
C. Meiosis II
1. Prophase II
a. Because chromosomes remain partially condensed, prophase II is brief.
b. Similar to mitotic prophase.
2. Metaphase II
a. Chromosomes line up on the midplanes of the cells.
b. Groups of two vs tetrads of metaphase I.
c. Not always obvious in living cells.
3. Anaphase II
a. Move to opposite poles, just as they would in mitotic anaphase.
b. Each former chromatid now called a chromosome, like in mitosis.
4. Telophase II
a. One representative for each homologous pair at each pole - each is an unduplicated (single) chromosome.
b. Nuclear envelopes reform.
c. Chromosomes gradually elongate to form chromatin fibers.
d. Cytokinesis occurs.
5. Genetic variation
a. DNA segments are exchanged between maternal and paternal homologues during cross-over.
b. Maternal and paternal chromosomes of homologous pairs separate independently - shuffled.
VI. Differences Between Mitosis & Meiosis
A. Nuclear divisions:
1. Mitosis is a single nuclear division in which sister chromatids separate from each other.
2. Meiosis - diploid cell undergoes two successive nuclear divisions (meiosis I & II)
B. Genetic composition and number of the daughter cells
1. Mitosis results in two identical cells.
2. Meiosis ends with four genetically different, haploid daughter cells.
a. Meiosis - synapsis to form tetrads (prophase I) which cross-over.
b. Meiosis I - homologous chromosomes separate.
c. Meiosis II - sister chromosomes separate.
VII. Reproduction
A. Asexual
1. Cloning of the cell.
2. Less genetic variation
3. Those that are genetically fit multiply.
B. Sexual
1. Genetic variation - offspring are different from both parents.
2. Those that are genetically fit may not have genetically fit offspring.
3. Possibility for more genetically fit offspring to arrise.
C. Variations in the Cycles (Fig. 10-17, page 230)
Energy & Metabolism
1. Matter & Energy
A. Terms:
Matter is anything that has mass and takes up space.
Energy is the capacity to do work, which is any change in the state or motion of matter.
E=mc2 - Matter and energy are interchangable
B. Types of energy
Potential energy is the capacity to do work as a result of position or state.
Kinetic energy is the energy of motion.
Chemical energy is a type of potential energy - stored in chemical bonds, important to organisms.
2. Laws of Thermodynamics
A. The first law of thermodynamics:
Energy cannot be created or destroyed, although it can be transferred or converted from one form to another, including conversions between matter and energy.
Organisms cannot create energy–must capture it from the surroundings.
B. The second law of thermodynamics:
When energy is converted from one form to another, some usable energy–that is, energy available to do work–is converted into heat that disperses into the surroundings.
Heat is the kinetic energy of randomly moving particles.
Unlike heat energy, which flows from an object with a higher temperature to one of lower temperature, this random motion cannot do work.
Total energy is not decreasing, but total usable energy is decreasing
Entropy (S) - a measure of the less-usable energy which is disordered or random
Usable energy has low entropy
Disorganized energy, such as heat, has high entropy
Organisms maintain high level of organization (low entropy) by importing low entropy energy sources
3. Energy & Metabolism
A. Terms
Metabolism - the sum of all the chemical activities taking place in an aroganism
Anabolism - various pathways that make more complex chemicals from simpler chemicals
Amino acids to dipeptids to proteins
Monosaccharides to polysaccharides to starch
Overall energy requirements - increasing order
3. Catabolism - various pathways that break down more complex chemicals
into simpler ones
Proteins to amino acids
Starch to monosaccharides (glucose)
Overall energy release - decreasing order
4. Enthalpy (H)
Total potential energy of the system
Bond Energy - energy required to break that bond
Total bond energy is equivalent to enthalpy (H)
5. Free energy/Gibbs free energy (G)
Amount of energy available to do work under the conditions of a biochemical reaction
Only kind of energy that can do cell work
Aspect of thermodynamics of greatest interest to biologists
6. G = H - TS or Free energy = Enthalpy (total potential energy) - T (absolute temperature in Kelvins) * S (entropy)
If entropy 0, free energy (G) = total potential energy (H)
As entropy increases, free energy decreases
As temperature increases, entropy increases
Measured in terms of change between initial state before a reaction and end state after a reaction
ΔG = ΔH -TΔS
B. Exergonic reactions
Releases energy
Spontaneous or ‘downhill’ reaction - from higher to lower free energy
ΔG (free energy) is a negative number
Spontaneous does not equal instantaneous - some happen very slowly
Some require activation energy to get started
Diffusion is a exergonic reaction
C. Endergonic reactions
Consumes energy/energy requiring
An ‘uphill’ reaction - from lower to higher free energy
Gain of free energy or ΔG (free energy) is a positive number
Does not happen in isolation - energy must be supplied by the surroundings
D. Free-energy changes depend on the concentrations of reactants and products
In biochemistry, little intrinsic free-energy difference between reactants and products
A W B
Dynamic equilibrium - rate of reverse reaction equals the rate of forward reaction
Increase initial concentration of A, force reaction to the right
Decrease the concentration of B as made, force reaction to the right
Visa versa
Cell reactions virtually never at equilibrium
E. ATP
Energy currency of the cell
Holds readily available energy for very short periods of time
Links exergonic and endergonic reactions (Fig 7-6)
Hydrolysis of ATP to ADP is exergonic - high energy because has a large -ΔG number
Phosphorylation reactions - example of glucose to sucrose (page 158)
Cannot be stored for very long
F. NAD+
Redox reactions - oxidation (lose of electrons) and reductions (gain of electrons) happens simultaneously
Happen in a series in the cells
Transfer of an electron is a transfer of energy
Not easy to remove an electron from a covalent compound - easier to transfer hydrogen (electron & proton)
Electron (either alone or part of hydrogen) transfers its energy (part of energy of chemical bond coming from) to acceptor
Loses energy with each transfer
NAD+ (nicotinamide adenine dinucleotide) - one of most frequently encountered acceptor molecules
Basic reaction (page 159)
Energy transferred to NADH (reduced form) from X when H is removed
Energy transferred to new X when NADH transfers H and is oxidized to NAD+
Specific reactions (Chapter 8)
9. Other electron acceptors:
NADP+ (nicotinamide adenine dinucleotide phosphate) - not involved in ATP synthesis, more in photosynthesis
FAD (flavin adenine dinucleotide)
Cytochromes - proteins that contain iron, which accepts the electron (more in Chapter 8)
3. Enzymes
A. Enzyme is a biological/organic catalyst - increases the speed of a chemical reaction without being consumed by the reaction.
All reactions have a required energy of activation (EA) or activation enery
- energy required to break the existing bonds
Molecules with relatively high kinetic energy are likely to react to form product - Flash point
Even an strongly exergonic reaction may be prevented from proceeding by the activation energy required to begin
Enzymes lower the activation energy of a reaction - speed up reaction rates
Doesn’t change free energy - can promote only a reaction that would proceed without it
Reactants and product reach equilibrium, no catalyst can cause a reaction to proceed in a thermodynamically unfavorable direction or can influence the final concentrations
B. How acts as a catalyst
Forms an unstable enzyme-substrate complex
Product releases when enzyme-substrate breaks up
Enzyme free to form another enzyme-substrate complex
Enzyme contains one or more active sites - regions to which the substrate binds to form ES complex
Grooves or cavities formed by amino acid side chains, usually close to the surface
Induced fit
Shape of enzyme not exactly complementary to the substrate
Binding of substrate induces a change in the shape of the enzyme and the substrate
Bonds in substrate may be distorted
Proximity and orientation of the reactants and strains in chemical bonds facilitate breakage of old bonds and formation of new ones
C. Enzymes are specific
Because shape of the active site is closely related to the shape of substrate, most enzymes are highly specific
Some catalyze reactions with only one substrate
Urease - decomposes urea to ammonia and carbon diooxide - no other substrate
Sucrase splits only sucrose
3. Few others catalyze reactions with a certain type of bond
Lipase - splits ester linkages connecting the glycerol and fatty acids of a wide variety of fats
D. CofactorsSome enzymes are only proteins
Others have two components: a protein called an apoenzyme and an additional chemical component called a cofactor
Apoenzyme and cofactor must be combined to function
Cofactor may be organic or inorganic
Inorganic can be trace metals, such as iron, copper, zinc, manganese
Organic are nonpolypeptides, usually carrier molecules for electron transfer, such as NADH, NADPH, and FADH2
ATP functions as a cofactor in phosphorylation reactions
Coenzyme A - transfers groups derived from organic acids - will discuss more in next chapter
Vitamins - cofactors or parts of cofactors the organism can’t manufacture by self
E. Optimal conditions
1. Each enzyme has an optimal temperature
Temperature too low - enzymatic reaction takes place slowly or not at all
Temperature too high - enzyme bonds responsible for secondary, tertiary and quaternary structures are broken; protein denatures; enzyme permanently inactivated as new shape is formed
Heat kills for this reason
Some organisms operate outside 35 - 40C human optimal range
Enzymes from organisms feeding on whale carcasses - cold water detergents
Enzymes from organisms living in hot pools, such as in Yellowstone - hot applications, such as PCR enzymes
2. Each enzyme has an optimal pH
Most enzymes are active over a narrow pH range, have optimal pH in which the reaction proceeds fastest
pH affects ionization of the amino acid side chains, etc.
Buffers minimize change in pH, help maintain optimal pH
Lysosome enzymes have optimal pH at lower pH than that of cell
Pepsin - protein splitter secreted by stomach - optimal pH of 2
Trypsin - protein splitter secreted by pancreas - optimal pH found in slightly basic environment of small intestine.
F. Regulation of enzymes
1. Cell can regulate pH, temperature, and enzyme and substrate concentration
2. Feedback inhibition
In a series of reactions, the end product may inhibit the first enzyme in the series
3. Reversible inhibition
Most enzyme can be inhibited by chemical agents
Reversible inhibition occurs when an inhibitor forms weak chemical bonds with the enzyme
Competitive inhibition - competes with the normal substrate for binding to the active site of the enzyme (Fig 7-17, page 167)
Noncompetitive inhibition - inhibitor binds with the enzyme at a site other than the active site
4. Allosteric sites and allosteric regulators - form of noncompetitive inhibition
Some enzymes have a site other than the active site, called an allosteric site
Substrate binds to allosteric site, changes the shape of the active site, affects enzyme activity
Allosteric activators - result in an enzyme with a functional active site
Allosteric inhibitors - result in an enzyme with a nonfunctional active site
Cell signaling examples - IP3 binds to calcium channels (Fig 6-9, page 144) to activate, cyclic AMP-dependant protein kinase (Fig 7-16, page 166) is inhibited by an allosteric inhibitor until inhibitor is removed (inhibited) by cAMP
5. Irreversible inhibition
An inhibitor permanently inactivates or destroys an enzyme when inhibitor combines with one of the enzyme’s functional groups, either at the active site or elsewhere
Many poisons are examples of irreversible inhibition - cyanide irreversibly inhibits action of cytochrome oxidase (Chapter 8) in mitochondria
Some drugs are irreversible inhibitors - penicillin irreversibly inhibits bacterial enzyme transpeptidase - establishes linkages in cell wall, cell wall ‘leaks’
Humans don’t produce cell walls, usually not affected by penicillin (except allergies)
Bacteria have fought back by producing penicillinase
Chapter 8 Outline
1. Stages of cellular respiration, terminating in aerobic respiration
A. Need to know’s
Table 8-1, page 173
Fig 8-2, page 173
Fig 8-4, pages 176 - 177
Fig 8-5, page 178
Fig 8-7, page 180
Fig 8-10, page 186
Table 8-2, page 187
Reactants & products
Enzymes
B. Overall significance or ‘purpose’ of cellular respiration
1. Cellular respiration - the name for some of the catabolic processes that convert the energy in the chemical bonds of nutrients to chemical energy stored in ATP
2. Cellular respiration may be aerobic or anaerobic.
3. Aerobic respiration requires oxygen.
4. Anaerobic pathways do not require oxygen
a. Anaerobic respiration
b. Fermentation
2. Aerobic respiration - four stages
A. Glycolysis
Fig 8-4, pages 176 - 177
B. Formation of acetyl coenzyme A
Fig 8-5, page 178
C. Citric acid cycle/Krebs Cycle
Fig 8-7, page 180
D. Electron transport & chemiosmosis
Fig 8-10, page 186
E. Two types of phosporylation:
1. Substrate-level phosphorylation: when a phosphate group is transferred to ADP from a phophorylated intermediate. Takes place during gycolysis in the cytosol and in the Krebs cycle in mitochondria.
2. Oxidative phosphorylation: production of ATP using energy derived from the transfer of electrons in the electron transport system - occurs only by chemiosmosis. Occurs in the matrix of mitochondria.
3. Anaerobic respiration
A. Table 8-2, page 187
B. Nitrate (NO3 -) or sulfate (SO4 2-) are the terminal electron acceptors instead of oxygen
C. Nitrogen cycle:
C6H12O6 + KNO3 6CO2 + 6H2O + 12 KNO2 + energy (in bonds of ATP)
potassium nitrate potassium nitrite
4. Fermentation
A. Fig 8-13, page 187
Chapter 9 Outline
1. Physical properties of light
A. Wavelength
1. Visible light represents a very small portion of a vast, continuous range of radiation called the electromagnetic spectrum.
2. All radiation in the electromagnetic spectrum travel in waves.
3. A wavelength is the distance between one wave peak and the next.
4. Fig. 9-1
a. Gamma rays have the shortest wavelength (fractions of nm) and TV and radio waves have the longest (measured in kilometers).
b. Visible spectrum or visible light is from 380 - 760 nm.
B. Photons
1. Light has both wave and particle properties.
2. Particles of light are called photons.
3. Photons have more energy when they have shorter wavelengths.
4. Photosynthesis uses the energy found in visible light.
2. Photosynthesis - General
A. Photosynthesis
1. Biological process that captures light energy and transforms it into the chemical energy of organic molecules (e.g. carbohydrates), which are manufactured from carbon dioxide and water.
2. Important to a plant because it generates energy and organic building blocks.
a. Plant uses energy to form ATP and NAPH.
b. Because ATP and NADPH are unstable, they are converted into more stable energy-storing molecules, such as glucose.
c. Glucose may then be stored as a part of sucrose, starch, etc.
d. ATP also fuels anabolic reactions that produce carbohydrates, proteins, fats, etc, that become part of the plant’s structure.
3. Important to other organisms because other organisms use energy-storing molecules and organic chemicals generated by plants.
a. Plants are autotrophs (photoautotrophs) because the chemical energy of ATP and NADPH then drives carbon fixation, the anabolic pathway in which stable organic molecules are synthesized from CO2 and water.
b. Chemoheterotrophs
1. Most animals, fungi, and most bacteria.
2. Chemotrophs because they obtain energy from chemicals.
3. Heterotrophs because they cannon fix carbon – use organic molecules produced by other organisms as the building blocks from which they synthesize the carbon compounds they need.
4. Photoheterotrophs - nonsulfur purple bacteria can use light energy but unable to carry out carbon-fixation and so need organic molecules from other organisms.
5. Chemoautotrophs - use oxidation of high energy, reduced compounds to obtain energy for carbon fixation.
B. Leaf structure
1. Mesophyll - a layer in the leaf with many air spaces and a very high concentration of water vapor.
2. Chloroplasts mainly found in cells of the mesophyll.
3. Interior of the leaf exchanges gasses with the outside through microscopic pores called stomata.
C. Chloroplast structure
1. Enclosed by outer and inner membranes.
2. Inner membrane encloses a fluid-filled region called the stroma - contains most of the enzymes for carbohydrate synthesis.
3. Suspended in the stroma is a third system of membranes that forms an interconnected set of flat, disclike sacs called thylakoids.
4. Thylakoid membrane encloses a fluid-filled interior space called the thylakoid lumen.
5. Thylakoids can be arranged in stacks called grana.
3. Light-dependent reactions
A. Take place in thylakoids of the choroplast
B. Noncyclic electron transport (Fig. 9-11 on page 199)
1. Explain photosystems I & II
a. Pigments - substances that absorb visible light.
1. Chlorophyll
The main pigment of photosynthesis.
Absorbs light mainly in the blue (422 - 492 nm) and red (647 - 760 nm).
Comes in two main forms, a and b.
Chlorophyll a initiates the light-dependant reactions of photosynthesis.
Chlorophyll b is an accessory pigment that helps absorb light.
2. Carotenoids
Yellow and orange pigments.
Absorb light in wavelengths other than those absorbed by chlorophyll.
Pass energy onto chlorophyll a.
b. Antenna complexes - chlorophyll a and b and accessory pigment molecules are organized with pigment-binding proteins in the thylakoid membrane into units called antenna complexes.
c. Each antenna complex absorbs light energy and transfers it to the reaction center.
1. P700 - Photosystem I reaction center consists of a pair of chlorophyll a molecules with an absorption peak at 700 nm.
2. P680 - Photosystem II reaction center consists of a pair of chlorophyll a molecules with an absorption peak at 680 nm.
2. Absorption of the light energy
a. Structure of chlorophyll
A long side chain that anchors the molecule in the membrane of the thylakoid.
Porphyrin ring made up of joined smaller rings (composed of carbon and nitrogen atoms) and an atom of magnesium in the center of the ring
b. Chlorophyll in the reaction center absorbs light energy passed to it from the antenna complex.
c. Light energy causes excitation of an electron in the magnesium atom (Mg).
d. Excited electron has more energy than it had before.
e. Energy can be released in two ways:
As light if the electron drops back to its original orbit.
It can be removed to an electron transport chain.
In chlorophyll, excited electron is removed to an electron transport chain.
2. Go over flow of electrons through photosystems I and II.
3. Go over products produced (look in other books - does Fig. 9-11 have a mistake in showing ATP synthesis? - does - ATP only generated by ATP synthase by chemiosmosis)
C. Cyclic electron transport (modify Fig 9-11)
1. Go over flow of electrons through photosystem I and reduction of NADPH to restore a electron to P700.
2. Some energy is used to pump H+ ions into the thylakoid lumen.
3. Energy from H+ gradient used to produce ATP.
4. No NADPH (required for carbon fixation) produced, no H2O split, and O2 is not generated.
5. Possible reasons for cyclic electron transport:
a. Occurs when too little NADP+ to accept electrons from ferredoxin.
b May help maintain the optimal ration of ATP to NADPH required for carbon fixation.
c May provide extra ATP for ATP-requiring processes in chloroplasts.
D. ATP synthesis (Fig 9-13 on page 201)
a. Explain how proton gradient is established across the thyakoid membrane.
b. Go over ATP synthesis by ATP synthase using the proton gradient (chemiosmosis).
4. Carbon fixation reactions/The Calvin cycle
A. Take place in the stoma of the chloroplast
B. Most plant use the Calvin cycle to fix carbon
1. Also known as the C3 pathway because the product of the initial carbon fixation reaction is a three-carbon compound, phosphoglycerate (PGA).
2. Plants that initially fix carbon in this way are called C3 plants.
C. The Calvin cycle (Fig 9-14 on page 203)
1. Summarize the three phases (CO2 uptake, Carbon reduction phase, and RuBP regeneration phase).
2. Indicate the roles of ATP and NADPH in this process.
5. Other carbon fixation pathways
A. Photorespiration
1. During hot temperatures, C3 plants balance need for CO2 with need to conserve water.
2. On hot dry days, leaves close stomata to conserve water.
3. Photosynthesis rapidly uses up the CO2 remaining the leaf - O2 accumulates in the chloroplasts.
4. CO2 and O2 compete for the active site of rubisco, which can act as either a carboxylase or an oxygenase - reaction can go either way.
5. Some intermediates are degraded to CO2 and H2O
a. Does not produce ATP
b. Removes intermediates from Calvin cycle
c. Reduces the photosynthetic efficiency
6. Called photorespiration because
a. It occurs in the presence of light
b. Requires oxygen
c. Produces CO2 and H2O (byproducts of aerobic respiration).
7. Many plants that live in hot, dry environments have adaptions that facilitate carbon fixation.
B. C4 pathway
1. C4 pathway efficiently fixes CO2 at low concentrations.
a. Called C4 because the product of the initial carbon fixation reaction is a four carbon compound, oxaloacetate (remember from Citric acid cycle).
b. C4 cycle used in conjunction with C3/Calvin cycle - separates the initial carbon fixation step from the rest of the Calvin cycle.
c. Plants that use the C4 cycle are called C4 plants.
2. Fig. 9-15 on page 205 - location of various cycles in C3 vs C4 plants.
3. Fig. 9-16 on page 206 to show interaction of the C3 and C4 pathways.
4. Because C4 pathway captures CO2 and provides it to the bundle sheath cells so efficiently, CO2 concentration within the bundle sheath cells is about 10 - 60 times as great as its concentration in the mesophyll cells of plants having only the C3 pathway - photorespiration is negligible.
C. CAM pathway
1. Plants living in very dry, or xeric (desert) conditions have special adaptions.
2. One is a carbon fixation pathway called the crassulacean acid metabolism (CAM) pathway.
a. Name comes from the stonecrop plant family (Crassulaceae).
b. Pathway evolved independently in other plant families.
3. Unlike most plants, open stomata at night.
a. Admit CO2.
b. Prevents water lose.
4. Use the enzyme PEP carboxylase to fix CO2 - forming oxaloacetate.
5. Oxaloacetate converted to malate.
6. Malate is stored in cell vacuoles.
7. During day, when stomata are closed, CO2 is removed from malate by decarboxylation.
8. CO2 is now available for use in the Calvin/C3 cycle.
D. Differences between C4 and CAM pathways.
1. C4 pathway - C3 and C4 pathways occur in different parts of the leaf.
2. CAM pathway - C3 and CAM pathways occur at different times in the leaf (day vs night).
3. Both maintain high levels of CO2 for use in the Calvin cycle to prevent photorespiration while preventing water lose.
Chapter 10 Outline
I. Organization of Eukaryotic Cell DNA (Fig. 10-4 on page 214)
A. DNA double helix - basic structure
1. Draw structure of a few connected nucleotides
2. Draw second, paired strand for double helix
3. In this form for replication and transcription
4. Genes
a. The term ‘gene’ has changed as we have gained understanding.
b. Always centered on being an informational unit.
May contribute to what we can see - eye color, hair color, height (polygenic), etc.
May be involved in regulation - regulator enzyme or regulatory molecule production.
May be involved in enzyme production, which is involved in protein, lipid, carbohydrate production - subunit or whole enzyme.
May be involved in structural protein production - subunit or whole protein.
B. Nucleosomes
1. DNA double helix very long - human sperm contains ~3x109 base pairs - 1 m long. Fits into a nucleus with a diameter of 10um.
2. Reasons for packaging DNA
a. Fit
b. Gene regulation
3. Packaging of DNA
a. Histones
Proteins that have a positive charge - high proportion of amino acids with basic side chains.
DNA has a negative charge because of the phosphate groups.
Histones and DNA associate to form structures called nucleosomes.
b. Nucleosomes
Fundamental unit of each nucleosome - beadlike structure with 146 base pairs of DNA wrapped around a disc-shaped core of eight histone molecules.
Histone molecules consist of two each of four different histone types.
Nucleosomes function like spools, preventing DNA from tangling.
Histones function in gene regulation - turned on or off.
Wrapping of DNA into nucleosomes represents the first level of
chromosome structure.
C. Packed nuclosomes
1. Another, fifth type of histone, histone H1, associates with the linker DNA.
2. Packs adjacent nucleosomes together to form a compacted 30-nm chromatin fiber.
D. Extended chromatin
1. Chromatin fibers form large, coiled loops held together by scaffolding proteins.
E. Chromosomes
1. Coiled loops interact to form the condensed chromatin in chromosomes.
2. Group of proteins called condensin.
Binds to DNA and wraps it into coiled loops that are compacted into a nitotic or meiotic chromosome.
DNA safely packaged for transport, so to speak.
II. Cell Cycle of an Eukaryotic Cell
A. Stages through which a cell passes from one cell division to the next are collectively referred to as the cell cycle.
1. Timing varies widely.
2. Nerve cells - years
3. Actively growing animal and plant cells - 8 - 20 hours.
B. Interphase - Time when no cell division is occurring - most of cell life.
1. G1
a. First gap phase
b. Growth and normal metabolism takes place
c. Typically longest phase
d. Cells that are not dividing usually become arrested in this part of the cell cycle and are said to be in a state called G0
e. Toward the end of G1, synthesis of proteins needed to initiate cells division and DNA sysnthesis
2. S
a. Synthesis phase
b. Chromosome duplication
DNA replication
Histone protein synthesis
3. G2
a. Second gap phase
b. Usually shorter than G1.
c. Synthesis of proteins needed for cell division.
C. M phase - Time when the cell is dividing.
1. Mitosis or Meiosis
a. Nuclear division
b. Insures that the correct number and kind of chromosomes goes to each new nucleus.
2. Cytokinesis
a. Division of the cell cytoplasm between two cells.
III. Mitosis (Fig 10-6, pages 216 - 217)
A. Nuclear division that produces two nuclei containing chromosomes identical to the parental nucleus
B. Interphase
1. Chromosomes are ‘unpacked’ into chromotin.
2. Nucleolus
3. Nuclear envelope
C. Prophase
1. Chromosome compaction - chromatin can be distributed to the daughter cells with less likelihood of tangling.
a. Sister chromatids - contain identical, double-stranded DNA sequences.
b. Each chromatid contains a constricted region called the centromere where sister chromatids are associated
c. Sister chromatids are physically linked by a ring-shaped protein complex called cohesion.
2. Kinetochore - multiprotein complex attached to centromere to which microtubles can bind.
3. Mitotic spindle develops
a. Structure that separates the duplicated chromosomes during anaphase.
b. Made up of microtubules, motor proteins, and controlled by variety of signaling molecules.
c. Microtubule-organizing center
Found in both plant and animal cells at the poles of the dividing cell
Animal cells have a pair of centrioles in the middle of each microtubule-organizing center
Centrioles surrounded by fibrils that make up the pericentriolar material
Late in propase, microtubules radiate from the pericentriolar material - called asters
Two asters migrate to two poles of the mitotic spindle
D. Prometaphase
1. Begins when nuclear envelope breaks up - sequestered for later use.
2. Nucleolus shrinks and usually disappears
3. Mitotic spindle completely assembled.
4. Duplicate chromosomes are scattered through out the nuclear region.
5. Spindle microtubules grow and shrink as they move towardd the center of the cell in a ‘search and capture’ process.
a. Microtubule comes near a kinetochore it is ‘captured’ by the kinetochore - kinetochore microtubles.
b. Move toward cell’s equator.
c. Sister chromatids kinetochore becomes attached to spindle from other pole.
6. Cohesins dissociate from sister chromatid arms but remain in the vicinity fo the centromere.
E. Metaphase
1. All cell’s chromosomes align at the cell’s midplane or metaphase plate.
2. Microtubules not connected to kinetochores are called polar microtubules or non-kinetochore microtubules - extend from each pole and overlap at equatorial region.
3. Kinetochore microtubules - extend from each pole to a kinetochore.
4. Each chromatid is completely condensed and easy to see - cells generally checked for karyotype (chromosome make up) at this stage if chromosome abnormalities are suspected.
5. Remaining cohesions dissociate from centromere.
F. Anaphase
1. Sister chromatids separate - now called chromosomes.
2. Chromosomes move to separate poles, using the microtubules as tracks.
Kinetochore lead way, arms trailing.
Micortubules depolymerize to shorten.
Polar microtubules slide against each other where they overlap at the poles, lengthening the spindle and pushing the poles apart.
3. Anaphase ends when all chromosomes reach poles.
G. Telophase
1. Arrival of the chromosomes at the poles.
2. Return of interphase nuclear conditions:
a. Chromosomes decondense by partially uncoiling.
b. New nuclear envelope forms around each set of chromosomes.
c. Spindle microtubules disappear.
d. Nucleoli reorganize.
IV. Cytokinesis
A. Division of cytoplasm to yeild two daughter cells.
1. Usually overlaps mitosis, beginning during telophase.
B. Animals & fungi
1. Actomyosin contractile ring attached to the plasma membrane encircles the cell in the equatorial region, at right angles to the spindle.
2. Contractile ring is an association between actin and myosin filaments.
3. Ring contracts, producing an cleavage furrow that gradually deepens and eventually separates the cytoplasm into two daughter cells.
B. Plants
1. Formation of a cell plate in the equatorial region.
2. Begins as a line of vesicles originating in the Golgi complex.
a. Contain materials to contruct both a primary cell wall and a middle lamella that cements the primary cell walls together.
b. Vesicles fuse to form plasma membrane of each daughter cell.
V. Meiosis (Fig. 10-13, pages 226 - 227)
A. Diploid vs Haploid
1. Diploid - two sets of each chromosome, one set from each parent.
a. Somatic cells - body cells.
b. Homologous chromosomes - carry information about the same trait - redundant system.
2. Haploid - one of each chromosome
a. Gamete formation for sexual reproduction.
b. Gametes fuse to form a zygote - return to diploid.
B. Meiosis I
1. Prophase I
a. Each duplicated chromosome (duplicated in interphase) consists of two chromatids, linked by cohsisn.
b. Synapsis
While chromatids are still elongated and thin, homologous chromosomes come to lie lengthwise side by side - synapsis (fastening together).
Results in two homologous pairs - association of four chromatids called a tetrad.
One homologous pair is called the maternal homologue, the other the paternal homologue.
Synaptonemal complex - proteinous structure holds homologous chromosomes together.
Crossing-over - enzymes break and rejoin DNA molecules, allowing paired homologous chromosomes to exchange genetic material.
Crossing-over results in genetic recombination.
c. Spindle forms.
d. Centrioles move to each pole.
e. Nuclear envelope disappears.
f. Centromeres and kinetochores of the homologous chromosomes become separated from one another - held together only where crossing-over had occurred
Called chiasmata.
Cohesions hold homologous chromosomes together after synaptonemal complex has disassembled.
2. Metaphase I
a. Tetrads align as midplate.
b. In contrast to mitosis, both sister kinetochores of one duplicated chromosome are attached to same pole.
3. Anaphase I
a. Paired homologous chromosomes separate and move toward opposite poles.
b. Each cell receives a random combination of maternal and paternal chromosomes, but only one member of each homologous pair is present at each pole.
c. Sister chromatids remain united at their centromers, unlike in mitosis.
4. Telophase I
a. Chromatids generally decondense somewhat, nuclear envelope may reform, and cytokinesis may take place.
b. Each nucleus contains the haploid number of chromosomes, but each chromsome is a duplicated chromosome (pair of chromatids).
c. A short interphase-like stage usually follows called interkinesis.
C. Meiosis II
1. Prophase II
a. Because chromosomes remain partially condensed, prophase II is brief.
b. Similar to mitotic prophase.
2. Metaphase II
a. Chromosomes line up on the midplanes of the cells.
b. Groups of two vs tetrads of metaphase I.
c. Not always obvious in living cells.
3. Anaphase II
a. Move to opposite poles, just as they would in mitotic anaphase.
b. Each former chromatid now called a chromosome, like in mitosis.
4. Telophase II
a. One representative for each homologous pair at each pole - each is an unduplicated (single) chromosome.
b. Nuclear envelopes reform.
c. Chromosomes gradually elongate to form chromatin fibers.
d. Cytokinesis occurs.
5. Genetic variation
a. DNA segments are exchanged between maternal and paternal homologues during cross-over.
b. Maternal and paternal chromosomes of homologous pairs separate independently - shuffled.
VI. Differences Between Mitosis & Meiosis
A. Nuclear divisions:
1. Mitosis is a single nuclear division in which sister chromatids separate from each other.
2. Meiosis - diploid cell undergoes two successive nuclear divisions (meiosis I & II)
B. Genetic composition and number of the daughter cells
1. Mitosis results in two identical cells.
2. Meiosis ends with four genetically different, haploid daughter cells.
a. Meiosis - synapsis to form tetrads (prophase I) which cross-over.
b. Meiosis I - homologous chromosomes separate.
c. Meiosis II - sister chromosomes separate.
VII. Reproduction
A. Asexual
1. Cloning of the cell.
2. Less genetic variation
3. Those that are genetically fit multiply.
B. Sexual
1. Genetic variation - offspring are different from both parents.
2. Those that are genetically fit may not have genetically fit offspring.
3. Possibility for more genetically fit offspring to arrise.
C. Variations in the Cycles (Fig. 10-17, page 230)
Tuesday, October 6, 2009
Study Guide for Test #2
Study Guide for Test #2
Chapter 4
1. Know the parts of cell theory.
2. Know the scientists who came up parts of the cell theory.
3. Know how larger cells can have an effective surface area to volume ratio.
4. Know the various organelles of both the animal and plant cells.
A. Nucleoli/nucleolus
B. Nucleus
C. Rough and smooth endoplasmic reticulum
D. Ribosomes
E. Golgi apparatus
F. Vesicles, including:
1. Lysosome
2. Perioxisome
3. Vacuole
G. Plasma membrane
H. Mitochondria
I. Chloroplast
J. Centriole
K. Cytoskeleton elements
1. Microtubules
a. Cilia
b. Flagella
c. Mitotic spindle
2. Intermediate filament
3. Actin filaments
a. Pseudopod
b. Cytoplasm division
L. Cytoplasm vs cytosol
5. Know their functions, structures, components, etc. Know what will happen if these structures are damaged or removed.
6. Be able to recognize them.
7. Know how the endomembrane system is connected.
8. Know which the direction the vesicles move within the endomembrane system.
9. Know the experiment performed by Bracht and Hammerling using Acetobularia.
Chapter 5
10. Know the following terms: diffusion, facilitated diffusion, osmosis, osmotic pressure, concentration gradient, passive transport, active transport.
11. Know how each of the above terms functions.
12. Know what kind of molecules can diffuse through a biological membrane.
13. Know the following terms: isotonic, hypertonic, hypotonic.
14. Know how plant cells and animal cells react in each of the types of solutions listed above.
15. Know the mechanism of the sodium - potassium pump.
16. Know the mechanism of GLUT1
17. Know the mechanism of the cotransport of sodium and glucose.
18. Know the ‘fluid mosaic model.’ Know the structure of a plasma membrane.
19. Know the difference between peripheral and integral membrane proteins.
A. Know the kinds of integral membrane proteins.
B. Know how peripheral proteins associate with the membrane.
20. Know the following: facilitated diffusions, pinocytosis, phagocytosis, exocytosis, receptor-mediated endocytosis. Know how each functions and proceeds. Know the reason for each process.
21. Know the various types of cell connections: dermatomes, tight junctions, gap junctions, plasmodesmata. Know their structures, functions, locations in cells, types of cells they are found in, etc.
22. Know how cholesterol functions within the membrane.
Chapter 6
23. Know the correct sequence of events in cell signaling.
24. Know the various types of signals: paracrine, hormone, neutrotransmitter. Know examples of each.
25. Know the characteristics of intracellular signals vs signals received by transmembrane receptor signals.
26. Know the following terms: signal cascade,
27. Know the functions of the following: adenylyl cyclase, protein kinase, tyrosine kinase, phospholipase C,
28. Know the different types of transmembrane receptors: G protein-linked, enzyme-linked, channel-linked.
29. Know how each kind of transmembrane receptor functions in cell communication/cell signaling. Know examples of each kind of cell communication with the different types of transmembrane receptor.
30. Know what a domain is as it relates to proteins. Know the functions of the different functions.
31. Know the example of the cholera toxin and how it prevents signal termination.
32. Know examples of second messangers and their functions within cell signaling.
In General
33. Know the answers to the quiz questions.
34. Know the answers to the Course Objectives.
Chapter 4
1. Know the parts of cell theory.
2. Know the scientists who came up parts of the cell theory.
3. Know how larger cells can have an effective surface area to volume ratio.
4. Know the various organelles of both the animal and plant cells.
A. Nucleoli/nucleolus
B. Nucleus
C. Rough and smooth endoplasmic reticulum
D. Ribosomes
E. Golgi apparatus
F. Vesicles, including:
1. Lysosome
2. Perioxisome
3. Vacuole
G. Plasma membrane
H. Mitochondria
I. Chloroplast
J. Centriole
K. Cytoskeleton elements
1. Microtubules
a. Cilia
b. Flagella
c. Mitotic spindle
2. Intermediate filament
3. Actin filaments
a. Pseudopod
b. Cytoplasm division
L. Cytoplasm vs cytosol
5. Know their functions, structures, components, etc. Know what will happen if these structures are damaged or removed.
6. Be able to recognize them.
7. Know how the endomembrane system is connected.
8. Know which the direction the vesicles move within the endomembrane system.
9. Know the experiment performed by Bracht and Hammerling using Acetobularia.
Chapter 5
10. Know the following terms: diffusion, facilitated diffusion, osmosis, osmotic pressure, concentration gradient, passive transport, active transport.
11. Know how each of the above terms functions.
12. Know what kind of molecules can diffuse through a biological membrane.
13. Know the following terms: isotonic, hypertonic, hypotonic.
14. Know how plant cells and animal cells react in each of the types of solutions listed above.
15. Know the mechanism of the sodium - potassium pump.
16. Know the mechanism of GLUT1
17. Know the mechanism of the cotransport of sodium and glucose.
18. Know the ‘fluid mosaic model.’ Know the structure of a plasma membrane.
19. Know the difference between peripheral and integral membrane proteins.
A. Know the kinds of integral membrane proteins.
B. Know how peripheral proteins associate with the membrane.
20. Know the following: facilitated diffusions, pinocytosis, phagocytosis, exocytosis, receptor-mediated endocytosis. Know how each functions and proceeds. Know the reason for each process.
21. Know the various types of cell connections: dermatomes, tight junctions, gap junctions, plasmodesmata. Know their structures, functions, locations in cells, types of cells they are found in, etc.
22. Know how cholesterol functions within the membrane.
Chapter 6
23. Know the correct sequence of events in cell signaling.
24. Know the various types of signals: paracrine, hormone, neutrotransmitter. Know examples of each.
25. Know the characteristics of intracellular signals vs signals received by transmembrane receptor signals.
26. Know the following terms: signal cascade,
27. Know the functions of the following: adenylyl cyclase, protein kinase, tyrosine kinase, phospholipase C,
28. Know the different types of transmembrane receptors: G protein-linked, enzyme-linked, channel-linked.
29. Know how each kind of transmembrane receptor functions in cell communication/cell signaling. Know examples of each kind of cell communication with the different types of transmembrane receptor.
30. Know what a domain is as it relates to proteins. Know the functions of the different functions.
31. Know the example of the cholera toxin and how it prevents signal termination.
32. Know examples of second messangers and their functions within cell signaling.
In General
33. Know the answers to the quiz questions.
34. Know the answers to the Course Objectives.
Wednesday, September 30, 2009
Lecture notes for Chapters 4 - 6
Hi, All.
Here are my notes for Chapters 4 - 6. Once again, the formating is a little strange, but it's still legible. If I every get a few spare moments, I'll edit the format. In the meantime, I hope they help with studying.
TR
Biol 1610
Chapter 4 Outline
Organization of the Cell
I. Cell theory.
A. What are the major statements of the cell theory?
1. Cells are the basic living units of organization and function in all organisms.
2. All cells come from other cells.
B. Be able name the 19th century biologists who are primarily responsible for formulating and stating cell theory.
1. Two German scientists - inductive reasoning that all plants and animals consist of cells
a. Inductive reasoning - begin with specific observations and draw a conclusion or discover a general principle.
b. Matthias Schleiden, botanist, 1838
c. Theodor Schwann, zoologist, 1839
2. Rudolf Virchow, 1855, observed dividing cells - proposed that new cells form only by division of previously existing cells
3. August Weismann, 1880, biologist - ancestry of all cells alive today can be traced back to ancient times
2. What features or abilities do all cells have in common?
A. Organization basically similar
1. Plasma membrane - chemical composition different inside than outside
2. Organelles - most have internal structures that are specialized to carry out metabolic activities
3. DNA concentrated in one area
B. Cell size is limited
1. Cells are small
2. Homeostasis - transport of materials in and out to maintain a constant internal concentration
3. Surface area to volume ratio
! As a cell gets bigger, its volume increases faster than surface area
! Less surface area for import/export - more distance to the center
! Can’t regulate its concentration of various ions
! Can’t efficiently export wastes
! Can’t transport needed molecules fast enough to sustain the cell
! Long and skinny, projections, all increase surface area
II. Major parts of a prokaryotic cell
A. Plasma membrane
1. Lipid bilayer that encloses the cells - separates outside from inside
2. Maybe infolded to form a complex of membranes along which many of the cell’s metabolic reactions take place
B. Nucleoid/nuclear area
1. Area in the cell where DNA is located/concentrated
2. Not enclosed in a membrane
C. Cytoplasm
1. Part of the cell inside the plasma membrane.
2. Cytosol is the fluid component
D. Ribosomes
1. Small complexes of ribonucleic acid and protein - polypeptide synthesis
2. Different sized subunits from eukaryotic ribosomes (16S)
E. Cell wall
1. Extracellular material that encloses the cell, including the plasma membrane
2. A few rare prokaryotic cells do not have a cell wall
F. Flagella
1. Long fibers that project from the cell and used in cell locomotion - propellers
2. Structure different from flagella in eukaryotic cells
III. Major parts of a eukaryotic cell (Table 4 - 1)
A. Plasma membrane
1. Lipid bilayer that encloses the cells - separates outside from inside
2. Several types of membranes are generally considered part of the internal membrane system or endomembrane system
B. Cell wall
1. Extracellular material that encloses the cell, including the plasma membrane
2. Not found in all eukaryotic cells - mainly fungi and plants
C. Nucleus
1. Membrane enclosed organelle which contains DNA.
2. Usually most prominent organelle in cell
3. Eukaryotic means “true nucleus.”
4. Nuclear envelope
a. Encloses DNA - ‘packed’ in chromatin 6 chromosomes when the cell is ready to divide.
b. Two concentric membranes that separate the nuclear contents from the surrounding cytoplasm.
c. Nuclear pores - membranes come together to form, consist of protein complexes - regulate the passage between nucleoplasm & cytoplasm.
d. Messenger RNA (mRNA) - synthesised in the nucleus and is transported out of the nucleus into the cytoplasm by the nuclear pores.
5. Nuclear lamina
a. Network of protein filaments form an inner lining for the nuclear envelope.
b. Give support, give shape.
c. May have other functions, such as organizing the contents of the nucleus.
6. Nucleoli/nucleolus - compact structures inside nucleus, not membrane inclosed.
a. Nucleolar organizer - inside nucleolus, made up of chromosomal regions containing instructions for making the type of RNA in ribosomes.
b. Ribosomal RNA synthesized in the nucleolus
D. Cytoplasm
1. Part of the cell inside the plasma membrane but outside of the nucleus.
2. Includes all the organelles outside the nucleus.
3. Cytosol is the fluid component.
E. Ribosomes
1. Found free in cytoplasm or bound to membranes.
2. Small complexes of ribonucleic acid and protein - polypeptide synthesis
3. Different sized subunits from prokaryotic ribosomes
4. Two subunits, one large and one small
F. Endoplasmic Reticulum (ER)
1. Parallel internal membranes that encircle nucleus and extend into may regions of the cytoplasm
2. ER lumen - internal space the membranes enclose
3. Membrane serves as a framework for enzymes that carry out sequential biochemical reactions
4. Different sizes & types in different cells
a. Rough ER
! Outer surface studded with ribosomes - bound ribosomes
! Central role in synthesis and assembly of proteins - for export from cell or those destined for other organelles
! Tunnel within the ribosome connects to an ER pore
! Within lumen, proteins are assembled, maybe modified (carbs or lipids)
! Molecular chaperones - aid in folding, transport of misfolded proteins to cytosol where proteasomes chop up the misfolded proteins
! Transport vesicles - small vesicles bud off, got to various sites in the cell
b. Smooth ER
! Tubular, smooth appearance
! Synthesis of many carbohydrates
! Primary site for synthesis of phospholipids & cholesterol
! In liver, important in glycogen breakdown
! Detox site in liver
G. Golgi complex/Golgi body/Golgi apparatus
1. Processes, sorts, & modifies proteins
2. Stacks of flattened membranous sacs called cisternae (cisterna)
3. One or many, depending on the cell
4. Each sac has an internal space or lumen - some separate, some connected
5. Three areas:
a. cis face - entry surface, nearest to nucleus, receives product from ER
b. trans face - exit surface, closest to plasma membrane, packages molecules in vesicles & transports them out of the Golgi
c. medial region - between cis and trans faces
6. General pathway -
a. Correctly formed proteins from ribosomes ER lumen
b. Vesicles move along the microtubules
c. cis face of the Golgi
d. Modified within the Golgi - carbs modified, signal molecules
e. Packaged into vesicles in the trans face
f. Pinched off and transported to specific destination - secreted, stored, transported within cell
H. Vesicles - small membrane bound sacs, pinched off of larger membranes
I. Lysosomes
1. Small sacs of digestive enzymes dispersed in the cytoplasm of most animal cells
2. Enzymes operate at rather acidic conditions - pH 5
3. Excellent example of benefits of separating functions within the cell by membranes - if enzymes loose in cell, do damage.
4. Break down bacteria, debris, old organelles
5. Primary lysosomes - bud off the Golgi, hydrolytic enzymes synthesized in the rough ER.
6. Bacteria enclosed in vesicles pinched off from plasma membrane
7. When two fuse, form secondary lysosomes
8. Tay-Sachs disease, in which a normal lipid cannot be broken down in brain cells - lipid accumulates and causes mental retradation, blindness, and death before age 5.
J. Peroxisomes
1. Membrane-enclosed organelles containing enzymes that catalyze an assortment of metabolic reactions in which hydrogen is transferred to oxygen.
2. During these reactions, they produce hydrogen peroxide
3. Hydrogen peroxide can be used to detoxify certain compounds, but would cause damage to the cell is released.
4. Peroxisomes contain catalase
5. Found in large numbers in cells that synthesize, store, or degrade lipids. One of their functions is to break down fatty acid molecules.
6. Synthesis certain phospholipids that are components of the insulating coverings of nerve cells.
7. Break down alcohol and other toxins
8. Specialized peroxisomes in plants called glyoxysomes convert stored fats to sugars
K. The Endomembrane system
1. Group of membranous structures in eukaryotic cells that interact through direct connections or by vesicles
2. Includes the endoplasmic reticulium, outer membrane of the nuclear envelope, Golgi complex, lysosomes, and the plasma membrane
3. How are the various organelles which collectively make up this system structurally and functionally related?
a. Structurally - connected either by direct connections or by vesicles
b. Functionally - all involved with enzymatic reactions: making and or breaking down cell products
K. Vacuoles
1. Large fluid-filled sacs with a variety of functions
2. Found in plants and yeasts, fills the function of lysosomes - break down wastes, old organelles
3. Wastes recycled in vacuoles or are stored
4. Plants, increase size of cell by addition of water
5. High concentration of solutes, water flows in, hydrostatic pressure - turgor pressure - mechanical strength of plant cells
6. Maintain pH, takes in excess H+
7. Unicellular protists
a. Food vacuoles - fuse with lysosomes to digest food
b. Contractile vacuoles - remove excess water from the cell
L. Mitochondria
1. Serial endosymbiosis
2. Function
a. Energy converting organelle - aerobic respiration
b. Affect health and aging - leak free radicals (toxic, highly reactive compounds with unpaired electrons)
c. Apoptosis - programed cell death vs necrosis, uncontrolled cell death, inflammation and neighboring cell damage
! Normal part of development and growth
! By interfering with energy metabolism or activating enzymes that mediate cell destruction
! Injured, large pores open up and leak cytochrome c
! Cytochrome c triggers apoptosis by activating caspases (enzymes) which cut up vital compounds in the cell
3. Structure
a. Like rod-shaped bacteria
b. Two membranes
c. Intermembrane space - compartment formed between the outer and inner mitochondiral membranes
d. Matrix - compartment enclosed by the inner mitochondrial membrane, contains enzymes that break down food molecules and convert them to chemical energy
e. Outer mitochondrial membrane - smooth and allows many small molecules to pass through it
f. Inner mitochondrial membrane - numerous folds (cristae/crista) and strictly regulates the types of molecules that can move across it. Cristae extend into the matrix and increase surface area - provide surface for matrix enzymes.
g. Mammalian - 5 - 10 identical, circular molecules of DNA, 1% of cell DNA
M. Chloroplasts
1. Similar to mitochondrion - serial endosymbiosis
2. Function
a. Convert light energy into chemical (ATP) energy
b. Chlorophyll - Photosynthesis
c. Carotenoids - light absorbing yellow and orange pigments
3. Structure
a. Typically disc-shaped
b. Two membranes
c. Outer membrane
d. Inter membrane
e. Intermembrane space
f. Stroma - space enclosed by inner membrane, contains enzymes that convert CO2 + H2O into sugars
g. Thylakoids -system of internal membranes, consist of interconnected set of flat disc-like sacs. Chlorophyll on thylakoid membrane, involved in ATP synthesis
h. Grana (granum) - stacks of thylakoids
i. Thylakoid lumen - inner most compartment of chloroplast
4. Plastids
a. Plastids - chloroplasts belong to a group of organelles known as plastids that produce and store food materials in cells of plants and algae
b. Proplastids - all plastids develop from, precursor organelles, sort of a plant stem cell, develop into a variety of plastids
c. Chloroplasts - develop when exposed to light
d. Chromoplasts - contain pigments that give some flowers and fruits their color - attract pollinators or seed disersers
e. Leucoplasts - unpigmented plastids, include amyloplasts which store starch in many seeds, roots, & tubers (potatoes)
N. Cytoskeleton - dense network of protein fibers, gives cells mechanical strength, shape, and ability to move, functions in cell division and internal cell transport
1. Microtubles
a. Function
! Structural role in cytoskeleton
! Involved with movement of chromosomes during cell division
! Serve as tracks for several other kinds of intracellular movement
! Major structural components of cilia and flagella
b. Structure
! Thickest filaments of the cytoskeleton
! Rigid, hollow rods about 25nm in outside diameter and up to several micrometers in length
! α-tubulin & β-tubulin dimers
! Elongates by addition
! Plus & minus ends, plus end elongates more rapidly
c. Microtubule-associated proteins (MAP’s)
d. Structural MAP’s - may help regulate microtubule assembly, cross-link microbules to theer cytoskeletal polymers
e. Motor MAP’s - use ATP enery to produce movement
f. Kinesin - motor protein moves organelles toward the plus end
g. Dynein - motor protein moves organelles toward the minus end, retrograde transport
h. Microtubule-organizing centers (MTOCs) - minus ends of microtubules appear to be organized in regions called
i. Centrosomes - in animal cells, main MTOC in the cell center
j. Centrioles - two structures in most centrosomes, 9X3 structures at right angles to each other - duplicated before cell division. Not found in all eukaryotic cells, mostly animal cells
k. Mitotic spindle - much of cytoskeleton disassembles during cell division, tubulin subunits organize into mitotic spindle, frame work for orderly distribution of chromosomes during cell division
l. Flagella - long (~200um) and relatively few extensions from the cell surface. 9+2 arrangement of microtubules. Dynein proteins and ATP facilate movement. Whip-like movement, perpendicular to cell surface.
m. Cilia - short (2-10 um) and many extensions from the cell surface. 9+2 arrangement of microtubules. Dynein proteins and ATP facilate movement. Oar-like movement, parallel to cell surface.
n. Basal body - anchor at base of flagella and cilia, under plasma membrane, 9x3 structure, organizes beginning growth of flagella and cilia but growth proceeds faster at ends. Replicates self, appears to be related to centrioles.
2. Microfilaments/actin filaments
a. Function
! Provide mechanical support for various cell structures
! Helps determine cell shape
! Generate movement by rapidly assembling and disassembling, sliding
b. Structure
! Flexible, solid fibers about 7nm in diameter
! Two intertwined polymer chains of actin molecules
! Linked with one another and other proteins by linker proteins - form bundles of fibers
c. Cell cortex - network of microfilaments visible just inside the plasma membrane, gel-like consistency, helps determine shape of cell
d. Myosin - filements composed of myosin associate with microfilaments.
e. Muscle cells - ATP binds to myosin, hydrolyzed to ADP, myosin binds to microfilaments and causes microfilaments to slide, contracting muscle cell
f. Dividing cells - ring of actin associated with myosin constricts the cell, forming two daughter cells
g. Pseudopodia - actin filaments push plasma membrane outward, contractions at other end, cytoplasm moves in direction of ‘push’
h. Microvilli - projections of plasma membrane that increases surface area
3. Intermediate filaments
a. Function
! Provide mechanical strength
! Help stabilize cell shape
! Abundant in regions that experience mechanical stress applied from outside the cell - prevent cell from stretching excessively in response to outside forces
b. Structure
* Tough, flexible fibers about 10nm in diameter * Certain proteins cross-link intermediate filaments with other types of filaments and mediate interactions between them
* Only found in some animal groups, including vertebrates, have intermediate filaments
* Vary widely in protein composition and size among different cell types, different organisms - keratins, neutrofilaments
O. Mention Integrins
1. Extracellular matrix (ECM)
a. Animals are surrounded by a gel of carbohydrates and fibrous proteins.
b. Secreted by the cell.
c. Function help the cell interact with the outside, give support to tissues.
2. Integrins
a. Proteins that serve as membrane receptors for the ECM - active in cell signaling
b. May be important in cell movement and in organizing the cytoskeleton so the cells assume a definite shape.
c. In some cells, anchor the ECM to the to the intermediate filaments and microfilaments of the internal cytoskeleton.
Chapter 5
Outline
Biological Membranes
I. Structure of a ‘typical’ biological membrane according to the fluid mosaic model
A. Phospholipid bilayer
1. General function a. Separate outside from inside - selectively permeable membrane
b. Spontaneously round up and form vesicles
c. Flexible - able to bend/change shape without breaking
B. Membrane proteins
1. General functions
a. Anchoring - anchor to extracellular matrix, attach to microfiliments within the cell (integrins)
b. Passive transport
c. Active transport
d. Enzymatic activity - catalyze activity within or on surface
e. Signal transduction - bind to receptors and pass information into the cell
f. Cell recognition - proteins recognized by cell/organism as self or non-self (MHC), antigens (destruction) vs tissue bonding
g. Intercellular junctions - attachment of cells to each other
2. Types of membrane proteins
a. Integral - firmly bound to the membrane, amphipathic
b. Transmembrane - integral proteins that extend completely through the membrane
• α-helixes most common transmembrane structure - hydrophobic amino acid side chains
• β-pleated sheets may roll up to form a barrel shape - pores
c. Peripheral - not firmly bound to the membrane, on outside or inside, usually noncovalently bound to exposed regions of integral proteins
3. How they get to the membrane
a. Outer surface membrane proteins - synthis is rough ER, sugars added in lumen (glycoproteins), transported to the Golgi, further modification, transport to plasma membrane
b. Inside (lumen of ER, Golgi, inside of vesicle) becomes outside of cell
II. Diffusion
A. Definition - physical process based on random motion
1. Atoms and molecules possess kinetic energy/energy of motion
2. Solids - atoms/molecules tightly packed, attractions allow for vibration only
3. Liquid - atoms/molecules farther apart, attractions are weaker, particles move about with considerable freedom
4. Gas - particles so far apart that intermolecular forces are negligible, movement only restricted by walls of container
5. Concentration gradient - areas of higher and lower concentration
6. Molecules will randomly move ‘down’ a concentration gradient, from higher to lower concentration
B. Example with blue dye in water, peeled orange
C. Physical properties that affect the diffusional rate of a molecule
1. Size
2. Shape
3. Electric charges
4. Temperature
D. Simple diffusion in the cell - small, uncharged/nonpolar molecules move directly through the membrane down their concentration gradient
1. Oxygen and carbon dioxide move by simple diffusion
2. Rate affected by concentration - higher the concentration on one side, the faster the diffusion down the gradient
3. No initial energy cost to the cell - cost comes from maintaining the gradient
III. Osmosis
A. Definition - net movement of water (principal solvent in a cell) through a selectively permeable membrane
1. Water can diffuse freely
2. Most solutes, such as sugars, salt, etc. cannot
3. Solutes bind water on one side of the membrane, so water doesn’t move freely
4. Water on other side free to move, moves down the gradient
B. Response of an animal cell (no cell wall) to following types of solutions:
1. Isotonic - no change, ion concentration same on both sides
2. Hypertonic - water flows out, cell becomes dehydrated and shrunken
3. Hypotonic solution - water flows in, cell swells or bursts
C. Response of a plant cell (cells with cell walls) to following types of solutions:
1. Isotonic - no change, ion concentration same on both sides
2. Hypertonic - water flows in, vacuole fills, plant fully turgid - healthy
3. Hypotonic - water flows out, become plasmolyzed & eventually dies
IV. Facilitated diffusion - a specific transport protein makes the membrane permeable to a particular solute. Always down the concentration gradient.
A. Channel proteins - form hydrophilic channels through the membrane
1. Porins - form rather large tunnels through which water and other solutes pass
2. Ion channels/gated channels - form narrow channels that transport specific ions down their gradients/electrochemical gradients, gated because they can open and close
B. Carrier proteins - bind to solute(s) on one side of the membrane, change shape, and release solute(s) on other side
1. Carrier mediated transport is slower than channel proteins but faster than by simple diffusion
2. Glucose transporter 1 (GLUT 1) transports glucose down the concentration gradient into RBCs
3. Higher concentration in blood than in cell
4. Binding the glucose changes the shape of GLUT 1 - releasing the glucose into the cytoplasm
5. ATP not consumed in conformational change
6. Once in cell, RBC phosphorylates the glucose - charged, different shape, no longer ‘part’ of the gradient
V. Active transport
A. Some times the cell needs solutes in greater concentration than are available outside the cell
B. Use active transport to move solutes into the cell against the concentration gradient
C. Similar to facilitated diffusion in that:
1. Membrane protein binds to a solute(s)
2. Binding the solute(s) cause a conformational change that releases the solute(s) into the cytoplasm
D. Differ in that:
1. Solutes are transported against the concentration gradient
2. Energy is consumed to transport the solute(s) into the cell - facilitated diffusion uses energy once the solute is in the cell, not to bring it in.
3. Direct active transport - ATP binds to the transport protein to provide energy for the transport
4. Indirect active transport - concentration gradient provides energy for the cotransport of some other substance, such as an ion
a. Sodium-potassium pump example. Fig 5 - 17, page 121
b. Because fewer potassium are imported vs sodium exported, inside cell is negatively charged
c. Membrane is polarized - establishes an electrochemical gradient across the membrane
d. Energy from the electrochemical gradient used to power other reactions - will get into in ATP generation inside mitochondria
E. What is a cotransport system?
1. Moves solutes across the membrane by indirect active transport
2. Carrier cotransports a solute against its concentration gradient while sodium, potassium, or hydrogen ions move down their concentration gradients
3. ATP energy produces the concentration gradient that powers the cotransport
4. Example of transport of glucose against its concentration gradient (starvation conditions, different part of the cell) by cotransportation of sodium down its concentration gradient. Fig 5 - 19, page 123. Meanwhile, the sodium-potassium pump is maintaining the Na concentration higher outside the cell.
VI. Exocytosis & Endocytosis
A. Diffusion (simple and facilitated) and carrier-mediated transport - individual molecules & ions transported
B. Exocytosis and endocytosis - large amounts, large molecules, small cells transported
C. Exocytosis and endocytosis both considered active transport
D. Exocytosis -
1. Ejection of waste products, hormones, etc., by fusion with the plasma membrane
2. Growth of the plasma membrane - addition
E. Endocytosis
1. Materials taken into the cell
2. Phagocytosis (cell eating)
a. Large solid particles bind to membrane
b. Enclosed by folds of membrane
c. Pinched off into a vesicle
d. Fuse with lysosomes
e. Particle degraded
4. Pinocytosis (cell drinking)
a. Cell takes in dissolved materials.
b. Tiny droplets trapped in folds of membrane
c. Pinch off into cytosol
d. Liquid contents slowly transferred to cytosol - vesicles become progressively smaller
F. Receptor-mediated endocytosis
1. Specific molecules combine with receptor proteins in the plasma membrane
2. Main mechanism by which cells take in macromolecules
3. Low-density lipoprotein transport example. Fig 5-23, page 126.
a. Cell makes LDL receptors, concentrate in a clathrin coated pit
b. LDL (the ligand) binds to the receptors
c. Coated pit becomes a coated vesicle
d. Clathrin removed - uncoated vesicle
e. Vesicles fuse with endosomes
f. LDL released from receptor
g. Receptors pinch off into a different vesicle, return to plasma membrane
h. LDL containing vesicle fuses with a lysosome, LDL degraded
i. Cholesterol released into the cytosol
VII. Cell connections
A. Cells close to each other typically develop intercellular junctions
1. Form strong connections
2. Prevent passage of materials
3. Establish rapid communications with each other
B. Tight junctions - animal cells
1. Seal off intercellular spaces between cells
2. Substances can not leak between them
3. Plasma membranes of the two cells in contact - proteins link/pass through both
4. Intermittent connections - not entire surface of plasma membrane
5. Intestinal lining, brain-blood barrier
C. Desmosomes - animal cells
1. Points of attachment - anchoring junction
2. Hold cells together like a rivet or spot weld - strength
3. Do not affect passage of materials between them
4. Structure
a. Dense disks on cytoplasm side of cell
b. Disks connected/anchored to intermediate filaments inside cell
c. Protein filaments cross the narrow intercellular space
d. Intermediate filaments networks connected across desmosomes, stress distributed across tissue
D. Gap junctions - animal cells
1. Like desmosome - spans space between cells but smaller
2. Contain channels that connect cytoplasm of adjacent cells
3. Connexin - integral membrane protein
4. Cluster of six connexin forms cylinders - join with connexin cylinder on other side, forms channel between cells but not to outside of cell
5. Channel can be opened and closed - fixed diameter open
6. Allows passage of small molecules (ions) and some regulatory molecules (cyclic AMP)
7. Provide for rapid chemical and electrical communication between the cells
a. Pancreatic cells (signaling to release insulin) & cardiac muscle cells (contract in unison)
E. Plasmodesmata - plants
1. Because have cell walls, don’t need desmosomes for strength
2. Cell walls isolate the cells
3. Plasmodesmata are channels about 20 - 40 nm wide through adjacent cells walls, connect cytoplasm
4. Plasmotubule - narrow cylindrical structure that runs through plasmodesmata and connects smooth ER of the two cells
5. Allows for passage of molecules and ions but not organelles
6. Allows for a type of slow electrical signaling in plants
7. Plasmodesmata channels can be dilated
Chapter 6 Outline
Cell Communication
General cell signaling (See Figure 6-2, page 136)
I. Signal of some sort is sent
A. Direct contact
1. Some immune cells - make direct contact and ligand on one cell binds to receptor on target cell
B. Local regulators
1. Signaling molecule that diffuses through the interstitial fluid and acts on neighboring cells
2. Called paracrine regulation
3. Types of local regulators:
a. Growth factors - typically peptides, stimulate cell division and normal development in specific cell types
b. Histamine - stored in E cells (check) and are released in response to allergic reactions, injury, infection, cause blood vessels to dilate and capillaries to become more permeable - allow passage of responding cells
c. Prostaglandins - modify cAMP levels and interact with other signaling molecules to either contract or relax smooth muscle
d. Nitric oxide - gas, many functions including dilation of blood vessels, decreasing blood pressure
C. Neurotransmitters
1. Chemical compounds released by neurons to signal one another
2. Diffuse across synapses - gaps between the neutrons
D. Hormones/long distance
1. Chemical messengers secreted by endocrine glands
1. No ducts - secreted into interstitial fluid, diffuse into capillaries
2. Transported by blood to target cells
II. Signal is received by target cell - signal molecule binds to membrane receptor or intracellular receptor and activates the receptor
A. Membrane receptors
1. Genes in cell code for specific receptors to be expressed on surface of the cell - proteins or glycoproteins
2. Recognize a specific ligand from a signaling cell - ligand is generally hydrophilic
3. 3 domains - domain is a structural and functional region of the protein
4. Receptor domains:
a. External docking domain - interacts with the ligand
b. Transmembrane domain
c. Intracellular ‘tail’ domain - transmits the signal within the cell
5. Types of membrane receptors (page 139) - all transmembrane proteins
6. Ion channel-linked receptors/ligand-gated channels
a. Converts chemical signals into electrical signals
b. Receptor may serve as the channel - opens or closes in response to binding of the ligand
c. Example: Acetylcholine
• Neurotransmitter that binds to an acetylcholine receptor - ligand-gated sodium ion channel
• Sodium channel opens, causing influx of sodium into the cell
• Decreases electric charge difference across the membrane (depolarization) which leads to muscle contraction
2. G-protein-linked receptors/G protein-coupled receptors
a. Transmembrane proteins that loop back and forth through the membrane 7 times - α-helixes
b. Intracellular portion (loops) have a binding site for a specific G-protein
c. G-proteins bind GTP, change shape, interact with another signal transduction protein
d. Discuss G-proteins more with signal transduction
3. Enzyme-linked receptors
a. Function directly as enzymes or are linked to enzymes
b. External binding site for ligand, enzyme component inside the cell
c. Example: Tyrosine kinases
• Bind growth factors
• Tyrosine kinases phosphorylates tyrosine residues on signal transduction protein(s) inside cell
• Phosphorylation - transfer of the terminal phophate group from an ATP molecule to the hydroxyl group on a target protein. In this case, the tyrosine residue of the target protein is phosphorylated.
• Phosphorylations changes shape of the target molecule, cause a new behavior or activation of behavior
B. Intracellular receptors
1. Some signaling molecules are small, hydrophobic molecules
2. Diffuse through plasma membrane and bind with an intracellular receptor
3. Most intracellular receptors are transcription factors, proteins that regulate the expression of specific genes
4. Examples: cortisol, sex hormones, Vitamins A & D, nitric oxide
III. Signal transduction
A. Ion-gated/ligand gated receptor transduction - change in electrical potential of the membrane caused the signal transduction
B. G-proteins
1. In group called first messengers
2. Inactive state, three subunits
3. One subunit bound to GDP (guanine diphosphate) - inactive state
4. Ligand binds receptor, receptor causes GDP to be released from subunit
5. GDP replaced with GTP and disassociates from other subunits - associates with second messenger
6. G-protein subunit is a GTPase - catalyzes conversion of GTP to GDP, returns to inactive state bound to other two subunits
C. Second messengers
1. Ions or small molecules that relay signal inside the cell
2. Second messengers may be produced in large amounts from one receptor-ligand interaction, amplifying the signal
3. Diffuse through cytosol or membrane to next target
4. Signaling cascade - a chain of molecules in the cell that relays signal
5. Second messenger examples:
a. Ca2+ ions - Ca2+ gates open, allow influx of Ca2+, Ca2+ binds to calmodulin, calmodulin changes shape and activates other enzymes
b. Phospholipids - G-protein activates membrane-bound phopholipase C, splits membrane phopholipid PIP2 into IP3 and DAG, both second messengers
c. cAMP (page 141)
• G-protein GTPase subunit interacts with adenylyl cyclase
• Adenylyl cyclase converts ATP to cAMP
• cAMP interacts with next target molecule, could be an enzyme that alters metabolism, a protein that alters gene activity, or a protein that opens or closes ion channels
• cAMP activates protein kinase A - protein kinase A physphoylates other molecules
D. Scaffolding proteins
1. Increase efficiency of the signal cascade
2. Organize the intracellular signaling molecules into signaling complexes
3. Position enzymes close to their substrates
IV. Response of the target cell
A. Ion channels open or close
B. Enzyme activity is altered - metabolic change or other effects
C. Specific gene activity may be turned on or off - changes in cell shape, growth, cell division, cell differentiation
D. Signal termination
1. Signal must be stopped or cell can’t respond to new signals
2. Returns receptor and signal transduction components back to the inactive state
3. Phosphorylated enzymes dephosporylated, etc.
E. Example of cell responce: Cholera
1. Normal scenario:
a. Ligand bonds to receptor in intestinal cell
b. Receptor activates G-protein
c. G-protein activates Adenylyl cyclase
d. Andenylyl cyclase converts ATP to cAMP
e. cAMP activates ion channel which allows chlorine ions into the intestine
f. Water follows
2. Cholera:
a. Toxin activates G-protein but doesn’t allow conversion of GTP to GDP - G-protein always on
b. Chlorine ions flood the intestine along with water
c. Patient dies of dehydration caused by sever diarrhea
Here are my notes for Chapters 4 - 6. Once again, the formating is a little strange, but it's still legible. If I every get a few spare moments, I'll edit the format. In the meantime, I hope they help with studying.
TR
Biol 1610
Chapter 4 Outline
Organization of the Cell
I. Cell theory.
A. What are the major statements of the cell theory?
1. Cells are the basic living units of organization and function in all organisms.
2. All cells come from other cells.
B. Be able name the 19th century biologists who are primarily responsible for formulating and stating cell theory.
1. Two German scientists - inductive reasoning that all plants and animals consist of cells
a. Inductive reasoning - begin with specific observations and draw a conclusion or discover a general principle.
b. Matthias Schleiden, botanist, 1838
c. Theodor Schwann, zoologist, 1839
2. Rudolf Virchow, 1855, observed dividing cells - proposed that new cells form only by division of previously existing cells
3. August Weismann, 1880, biologist - ancestry of all cells alive today can be traced back to ancient times
2. What features or abilities do all cells have in common?
A. Organization basically similar
1. Plasma membrane - chemical composition different inside than outside
2. Organelles - most have internal structures that are specialized to carry out metabolic activities
3. DNA concentrated in one area
B. Cell size is limited
1. Cells are small
2. Homeostasis - transport of materials in and out to maintain a constant internal concentration
3. Surface area to volume ratio
! As a cell gets bigger, its volume increases faster than surface area
! Less surface area for import/export - more distance to the center
! Can’t regulate its concentration of various ions
! Can’t efficiently export wastes
! Can’t transport needed molecules fast enough to sustain the cell
! Long and skinny, projections, all increase surface area
II. Major parts of a prokaryotic cell
A. Plasma membrane
1. Lipid bilayer that encloses the cells - separates outside from inside
2. Maybe infolded to form a complex of membranes along which many of the cell’s metabolic reactions take place
B. Nucleoid/nuclear area
1. Area in the cell where DNA is located/concentrated
2. Not enclosed in a membrane
C. Cytoplasm
1. Part of the cell inside the plasma membrane.
2. Cytosol is the fluid component
D. Ribosomes
1. Small complexes of ribonucleic acid and protein - polypeptide synthesis
2. Different sized subunits from eukaryotic ribosomes (16S)
E. Cell wall
1. Extracellular material that encloses the cell, including the plasma membrane
2. A few rare prokaryotic cells do not have a cell wall
F. Flagella
1. Long fibers that project from the cell and used in cell locomotion - propellers
2. Structure different from flagella in eukaryotic cells
III. Major parts of a eukaryotic cell (Table 4 - 1)
A. Plasma membrane
1. Lipid bilayer that encloses the cells - separates outside from inside
2. Several types of membranes are generally considered part of the internal membrane system or endomembrane system
B. Cell wall
1. Extracellular material that encloses the cell, including the plasma membrane
2. Not found in all eukaryotic cells - mainly fungi and plants
C. Nucleus
1. Membrane enclosed organelle which contains DNA.
2. Usually most prominent organelle in cell
3. Eukaryotic means “true nucleus.”
4. Nuclear envelope
a. Encloses DNA - ‘packed’ in chromatin 6 chromosomes when the cell is ready to divide.
b. Two concentric membranes that separate the nuclear contents from the surrounding cytoplasm.
c. Nuclear pores - membranes come together to form, consist of protein complexes - regulate the passage between nucleoplasm & cytoplasm.
d. Messenger RNA (mRNA) - synthesised in the nucleus and is transported out of the nucleus into the cytoplasm by the nuclear pores.
5. Nuclear lamina
a. Network of protein filaments form an inner lining for the nuclear envelope.
b. Give support, give shape.
c. May have other functions, such as organizing the contents of the nucleus.
6. Nucleoli/nucleolus - compact structures inside nucleus, not membrane inclosed.
a. Nucleolar organizer - inside nucleolus, made up of chromosomal regions containing instructions for making the type of RNA in ribosomes.
b. Ribosomal RNA synthesized in the nucleolus
D. Cytoplasm
1. Part of the cell inside the plasma membrane but outside of the nucleus.
2. Includes all the organelles outside the nucleus.
3. Cytosol is the fluid component.
E. Ribosomes
1. Found free in cytoplasm or bound to membranes.
2. Small complexes of ribonucleic acid and protein - polypeptide synthesis
3. Different sized subunits from prokaryotic ribosomes
4. Two subunits, one large and one small
F. Endoplasmic Reticulum (ER)
1. Parallel internal membranes that encircle nucleus and extend into may regions of the cytoplasm
2. ER lumen - internal space the membranes enclose
3. Membrane serves as a framework for enzymes that carry out sequential biochemical reactions
4. Different sizes & types in different cells
a. Rough ER
! Outer surface studded with ribosomes - bound ribosomes
! Central role in synthesis and assembly of proteins - for export from cell or those destined for other organelles
! Tunnel within the ribosome connects to an ER pore
! Within lumen, proteins are assembled, maybe modified (carbs or lipids)
! Molecular chaperones - aid in folding, transport of misfolded proteins to cytosol where proteasomes chop up the misfolded proteins
! Transport vesicles - small vesicles bud off, got to various sites in the cell
b. Smooth ER
! Tubular, smooth appearance
! Synthesis of many carbohydrates
! Primary site for synthesis of phospholipids & cholesterol
! In liver, important in glycogen breakdown
! Detox site in liver
G. Golgi complex/Golgi body/Golgi apparatus
1. Processes, sorts, & modifies proteins
2. Stacks of flattened membranous sacs called cisternae (cisterna)
3. One or many, depending on the cell
4. Each sac has an internal space or lumen - some separate, some connected
5. Three areas:
a. cis face - entry surface, nearest to nucleus, receives product from ER
b. trans face - exit surface, closest to plasma membrane, packages molecules in vesicles & transports them out of the Golgi
c. medial region - between cis and trans faces
6. General pathway -
a. Correctly formed proteins from ribosomes ER lumen
b. Vesicles move along the microtubules
c. cis face of the Golgi
d. Modified within the Golgi - carbs modified, signal molecules
e. Packaged into vesicles in the trans face
f. Pinched off and transported to specific destination - secreted, stored, transported within cell
H. Vesicles - small membrane bound sacs, pinched off of larger membranes
I. Lysosomes
1. Small sacs of digestive enzymes dispersed in the cytoplasm of most animal cells
2. Enzymes operate at rather acidic conditions - pH 5
3. Excellent example of benefits of separating functions within the cell by membranes - if enzymes loose in cell, do damage.
4. Break down bacteria, debris, old organelles
5. Primary lysosomes - bud off the Golgi, hydrolytic enzymes synthesized in the rough ER.
6. Bacteria enclosed in vesicles pinched off from plasma membrane
7. When two fuse, form secondary lysosomes
8. Tay-Sachs disease, in which a normal lipid cannot be broken down in brain cells - lipid accumulates and causes mental retradation, blindness, and death before age 5.
J. Peroxisomes
1. Membrane-enclosed organelles containing enzymes that catalyze an assortment of metabolic reactions in which hydrogen is transferred to oxygen.
2. During these reactions, they produce hydrogen peroxide
3. Hydrogen peroxide can be used to detoxify certain compounds, but would cause damage to the cell is released.
4. Peroxisomes contain catalase
5. Found in large numbers in cells that synthesize, store, or degrade lipids. One of their functions is to break down fatty acid molecules.
6. Synthesis certain phospholipids that are components of the insulating coverings of nerve cells.
7. Break down alcohol and other toxins
8. Specialized peroxisomes in plants called glyoxysomes convert stored fats to sugars
K. The Endomembrane system
1. Group of membranous structures in eukaryotic cells that interact through direct connections or by vesicles
2. Includes the endoplasmic reticulium, outer membrane of the nuclear envelope, Golgi complex, lysosomes, and the plasma membrane
3. How are the various organelles which collectively make up this system structurally and functionally related?
a. Structurally - connected either by direct connections or by vesicles
b. Functionally - all involved with enzymatic reactions: making and or breaking down cell products
K. Vacuoles
1. Large fluid-filled sacs with a variety of functions
2. Found in plants and yeasts, fills the function of lysosomes - break down wastes, old organelles
3. Wastes recycled in vacuoles or are stored
4. Plants, increase size of cell by addition of water
5. High concentration of solutes, water flows in, hydrostatic pressure - turgor pressure - mechanical strength of plant cells
6. Maintain pH, takes in excess H+
7. Unicellular protists
a. Food vacuoles - fuse with lysosomes to digest food
b. Contractile vacuoles - remove excess water from the cell
L. Mitochondria
1. Serial endosymbiosis
2. Function
a. Energy converting organelle - aerobic respiration
b. Affect health and aging - leak free radicals (toxic, highly reactive compounds with unpaired electrons)
c. Apoptosis - programed cell death vs necrosis, uncontrolled cell death, inflammation and neighboring cell damage
! Normal part of development and growth
! By interfering with energy metabolism or activating enzymes that mediate cell destruction
! Injured, large pores open up and leak cytochrome c
! Cytochrome c triggers apoptosis by activating caspases (enzymes) which cut up vital compounds in the cell
3. Structure
a. Like rod-shaped bacteria
b. Two membranes
c. Intermembrane space - compartment formed between the outer and inner mitochondiral membranes
d. Matrix - compartment enclosed by the inner mitochondrial membrane, contains enzymes that break down food molecules and convert them to chemical energy
e. Outer mitochondrial membrane - smooth and allows many small molecules to pass through it
f. Inner mitochondrial membrane - numerous folds (cristae/crista) and strictly regulates the types of molecules that can move across it. Cristae extend into the matrix and increase surface area - provide surface for matrix enzymes.
g. Mammalian - 5 - 10 identical, circular molecules of DNA, 1% of cell DNA
M. Chloroplasts
1. Similar to mitochondrion - serial endosymbiosis
2. Function
a. Convert light energy into chemical (ATP) energy
b. Chlorophyll - Photosynthesis
c. Carotenoids - light absorbing yellow and orange pigments
3. Structure
a. Typically disc-shaped
b. Two membranes
c. Outer membrane
d. Inter membrane
e. Intermembrane space
f. Stroma - space enclosed by inner membrane, contains enzymes that convert CO2 + H2O into sugars
g. Thylakoids -system of internal membranes, consist of interconnected set of flat disc-like sacs. Chlorophyll on thylakoid membrane, involved in ATP synthesis
h. Grana (granum) - stacks of thylakoids
i. Thylakoid lumen - inner most compartment of chloroplast
4. Plastids
a. Plastids - chloroplasts belong to a group of organelles known as plastids that produce and store food materials in cells of plants and algae
b. Proplastids - all plastids develop from, precursor organelles, sort of a plant stem cell, develop into a variety of plastids
c. Chloroplasts - develop when exposed to light
d. Chromoplasts - contain pigments that give some flowers and fruits their color - attract pollinators or seed disersers
e. Leucoplasts - unpigmented plastids, include amyloplasts which store starch in many seeds, roots, & tubers (potatoes)
N. Cytoskeleton - dense network of protein fibers, gives cells mechanical strength, shape, and ability to move, functions in cell division and internal cell transport
1. Microtubles
a. Function
! Structural role in cytoskeleton
! Involved with movement of chromosomes during cell division
! Serve as tracks for several other kinds of intracellular movement
! Major structural components of cilia and flagella
b. Structure
! Thickest filaments of the cytoskeleton
! Rigid, hollow rods about 25nm in outside diameter and up to several micrometers in length
! α-tubulin & β-tubulin dimers
! Elongates by addition
! Plus & minus ends, plus end elongates more rapidly
c. Microtubule-associated proteins (MAP’s)
d. Structural MAP’s - may help regulate microtubule assembly, cross-link microbules to theer cytoskeletal polymers
e. Motor MAP’s - use ATP enery to produce movement
f. Kinesin - motor protein moves organelles toward the plus end
g. Dynein - motor protein moves organelles toward the minus end, retrograde transport
h. Microtubule-organizing centers (MTOCs) - minus ends of microtubules appear to be organized in regions called
i. Centrosomes - in animal cells, main MTOC in the cell center
j. Centrioles - two structures in most centrosomes, 9X3 structures at right angles to each other - duplicated before cell division. Not found in all eukaryotic cells, mostly animal cells
k. Mitotic spindle - much of cytoskeleton disassembles during cell division, tubulin subunits organize into mitotic spindle, frame work for orderly distribution of chromosomes during cell division
l. Flagella - long (~200um) and relatively few extensions from the cell surface. 9+2 arrangement of microtubules. Dynein proteins and ATP facilate movement. Whip-like movement, perpendicular to cell surface.
m. Cilia - short (2-10 um) and many extensions from the cell surface. 9+2 arrangement of microtubules. Dynein proteins and ATP facilate movement. Oar-like movement, parallel to cell surface.
n. Basal body - anchor at base of flagella and cilia, under plasma membrane, 9x3 structure, organizes beginning growth of flagella and cilia but growth proceeds faster at ends. Replicates self, appears to be related to centrioles.
2. Microfilaments/actin filaments
a. Function
! Provide mechanical support for various cell structures
! Helps determine cell shape
! Generate movement by rapidly assembling and disassembling, sliding
b. Structure
! Flexible, solid fibers about 7nm in diameter
! Two intertwined polymer chains of actin molecules
! Linked with one another and other proteins by linker proteins - form bundles of fibers
c. Cell cortex - network of microfilaments visible just inside the plasma membrane, gel-like consistency, helps determine shape of cell
d. Myosin - filements composed of myosin associate with microfilaments.
e. Muscle cells - ATP binds to myosin, hydrolyzed to ADP, myosin binds to microfilaments and causes microfilaments to slide, contracting muscle cell
f. Dividing cells - ring of actin associated with myosin constricts the cell, forming two daughter cells
g. Pseudopodia - actin filaments push plasma membrane outward, contractions at other end, cytoplasm moves in direction of ‘push’
h. Microvilli - projections of plasma membrane that increases surface area
3. Intermediate filaments
a. Function
! Provide mechanical strength
! Help stabilize cell shape
! Abundant in regions that experience mechanical stress applied from outside the cell - prevent cell from stretching excessively in response to outside forces
b. Structure
* Tough, flexible fibers about 10nm in diameter * Certain proteins cross-link intermediate filaments with other types of filaments and mediate interactions between them
* Only found in some animal groups, including vertebrates, have intermediate filaments
* Vary widely in protein composition and size among different cell types, different organisms - keratins, neutrofilaments
O. Mention Integrins
1. Extracellular matrix (ECM)
a. Animals are surrounded by a gel of carbohydrates and fibrous proteins.
b. Secreted by the cell.
c. Function help the cell interact with the outside, give support to tissues.
2. Integrins
a. Proteins that serve as membrane receptors for the ECM - active in cell signaling
b. May be important in cell movement and in organizing the cytoskeleton so the cells assume a definite shape.
c. In some cells, anchor the ECM to the to the intermediate filaments and microfilaments of the internal cytoskeleton.
Chapter 5
Outline
Biological Membranes
I. Structure of a ‘typical’ biological membrane according to the fluid mosaic model
A. Phospholipid bilayer
1. General function a. Separate outside from inside - selectively permeable membrane
b. Spontaneously round up and form vesicles
c. Flexible - able to bend/change shape without breaking
B. Membrane proteins
1. General functions
a. Anchoring - anchor to extracellular matrix, attach to microfiliments within the cell (integrins)
b. Passive transport
c. Active transport
d. Enzymatic activity - catalyze activity within or on surface
e. Signal transduction - bind to receptors and pass information into the cell
f. Cell recognition - proteins recognized by cell/organism as self or non-self (MHC), antigens (destruction) vs tissue bonding
g. Intercellular junctions - attachment of cells to each other
2. Types of membrane proteins
a. Integral - firmly bound to the membrane, amphipathic
b. Transmembrane - integral proteins that extend completely through the membrane
• α-helixes most common transmembrane structure - hydrophobic amino acid side chains
• β-pleated sheets may roll up to form a barrel shape - pores
c. Peripheral - not firmly bound to the membrane, on outside or inside, usually noncovalently bound to exposed regions of integral proteins
3. How they get to the membrane
a. Outer surface membrane proteins - synthis is rough ER, sugars added in lumen (glycoproteins), transported to the Golgi, further modification, transport to plasma membrane
b. Inside (lumen of ER, Golgi, inside of vesicle) becomes outside of cell
II. Diffusion
A. Definition - physical process based on random motion
1. Atoms and molecules possess kinetic energy/energy of motion
2. Solids - atoms/molecules tightly packed, attractions allow for vibration only
3. Liquid - atoms/molecules farther apart, attractions are weaker, particles move about with considerable freedom
4. Gas - particles so far apart that intermolecular forces are negligible, movement only restricted by walls of container
5. Concentration gradient - areas of higher and lower concentration
6. Molecules will randomly move ‘down’ a concentration gradient, from higher to lower concentration
B. Example with blue dye in water, peeled orange
C. Physical properties that affect the diffusional rate of a molecule
1. Size
2. Shape
3. Electric charges
4. Temperature
D. Simple diffusion in the cell - small, uncharged/nonpolar molecules move directly through the membrane down their concentration gradient
1. Oxygen and carbon dioxide move by simple diffusion
2. Rate affected by concentration - higher the concentration on one side, the faster the diffusion down the gradient
3. No initial energy cost to the cell - cost comes from maintaining the gradient
III. Osmosis
A. Definition - net movement of water (principal solvent in a cell) through a selectively permeable membrane
1. Water can diffuse freely
2. Most solutes, such as sugars, salt, etc. cannot
3. Solutes bind water on one side of the membrane, so water doesn’t move freely
4. Water on other side free to move, moves down the gradient
B. Response of an animal cell (no cell wall) to following types of solutions:
1. Isotonic - no change, ion concentration same on both sides
2. Hypertonic - water flows out, cell becomes dehydrated and shrunken
3. Hypotonic solution - water flows in, cell swells or bursts
C. Response of a plant cell (cells with cell walls) to following types of solutions:
1. Isotonic - no change, ion concentration same on both sides
2. Hypertonic - water flows in, vacuole fills, plant fully turgid - healthy
3. Hypotonic - water flows out, become plasmolyzed & eventually dies
IV. Facilitated diffusion - a specific transport protein makes the membrane permeable to a particular solute. Always down the concentration gradient.
A. Channel proteins - form hydrophilic channels through the membrane
1. Porins - form rather large tunnels through which water and other solutes pass
2. Ion channels/gated channels - form narrow channels that transport specific ions down their gradients/electrochemical gradients, gated because they can open and close
B. Carrier proteins - bind to solute(s) on one side of the membrane, change shape, and release solute(s) on other side
1. Carrier mediated transport is slower than channel proteins but faster than by simple diffusion
2. Glucose transporter 1 (GLUT 1) transports glucose down the concentration gradient into RBCs
3. Higher concentration in blood than in cell
4. Binding the glucose changes the shape of GLUT 1 - releasing the glucose into the cytoplasm
5. ATP not consumed in conformational change
6. Once in cell, RBC phosphorylates the glucose - charged, different shape, no longer ‘part’ of the gradient
V. Active transport
A. Some times the cell needs solutes in greater concentration than are available outside the cell
B. Use active transport to move solutes into the cell against the concentration gradient
C. Similar to facilitated diffusion in that:
1. Membrane protein binds to a solute(s)
2. Binding the solute(s) cause a conformational change that releases the solute(s) into the cytoplasm
D. Differ in that:
1. Solutes are transported against the concentration gradient
2. Energy is consumed to transport the solute(s) into the cell - facilitated diffusion uses energy once the solute is in the cell, not to bring it in.
3. Direct active transport - ATP binds to the transport protein to provide energy for the transport
4. Indirect active transport - concentration gradient provides energy for the cotransport of some other substance, such as an ion
a. Sodium-potassium pump example. Fig 5 - 17, page 121
b. Because fewer potassium are imported vs sodium exported, inside cell is negatively charged
c. Membrane is polarized - establishes an electrochemical gradient across the membrane
d. Energy from the electrochemical gradient used to power other reactions - will get into in ATP generation inside mitochondria
E. What is a cotransport system?
1. Moves solutes across the membrane by indirect active transport
2. Carrier cotransports a solute against its concentration gradient while sodium, potassium, or hydrogen ions move down their concentration gradients
3. ATP energy produces the concentration gradient that powers the cotransport
4. Example of transport of glucose against its concentration gradient (starvation conditions, different part of the cell) by cotransportation of sodium down its concentration gradient. Fig 5 - 19, page 123. Meanwhile, the sodium-potassium pump is maintaining the Na concentration higher outside the cell.
VI. Exocytosis & Endocytosis
A. Diffusion (simple and facilitated) and carrier-mediated transport - individual molecules & ions transported
B. Exocytosis and endocytosis - large amounts, large molecules, small cells transported
C. Exocytosis and endocytosis both considered active transport
D. Exocytosis -
1. Ejection of waste products, hormones, etc., by fusion with the plasma membrane
2. Growth of the plasma membrane - addition
E. Endocytosis
1. Materials taken into the cell
2. Phagocytosis (cell eating)
a. Large solid particles bind to membrane
b. Enclosed by folds of membrane
c. Pinched off into a vesicle
d. Fuse with lysosomes
e. Particle degraded
4. Pinocytosis (cell drinking)
a. Cell takes in dissolved materials.
b. Tiny droplets trapped in folds of membrane
c. Pinch off into cytosol
d. Liquid contents slowly transferred to cytosol - vesicles become progressively smaller
F. Receptor-mediated endocytosis
1. Specific molecules combine with receptor proteins in the plasma membrane
2. Main mechanism by which cells take in macromolecules
3. Low-density lipoprotein transport example. Fig 5-23, page 126.
a. Cell makes LDL receptors, concentrate in a clathrin coated pit
b. LDL (the ligand) binds to the receptors
c. Coated pit becomes a coated vesicle
d. Clathrin removed - uncoated vesicle
e. Vesicles fuse with endosomes
f. LDL released from receptor
g. Receptors pinch off into a different vesicle, return to plasma membrane
h. LDL containing vesicle fuses with a lysosome, LDL degraded
i. Cholesterol released into the cytosol
VII. Cell connections
A. Cells close to each other typically develop intercellular junctions
1. Form strong connections
2. Prevent passage of materials
3. Establish rapid communications with each other
B. Tight junctions - animal cells
1. Seal off intercellular spaces between cells
2. Substances can not leak between them
3. Plasma membranes of the two cells in contact - proteins link/pass through both
4. Intermittent connections - not entire surface of plasma membrane
5. Intestinal lining, brain-blood barrier
C. Desmosomes - animal cells
1. Points of attachment - anchoring junction
2. Hold cells together like a rivet or spot weld - strength
3. Do not affect passage of materials between them
4. Structure
a. Dense disks on cytoplasm side of cell
b. Disks connected/anchored to intermediate filaments inside cell
c. Protein filaments cross the narrow intercellular space
d. Intermediate filaments networks connected across desmosomes, stress distributed across tissue
D. Gap junctions - animal cells
1. Like desmosome - spans space between cells but smaller
2. Contain channels that connect cytoplasm of adjacent cells
3. Connexin - integral membrane protein
4. Cluster of six connexin forms cylinders - join with connexin cylinder on other side, forms channel between cells but not to outside of cell
5. Channel can be opened and closed - fixed diameter open
6. Allows passage of small molecules (ions) and some regulatory molecules (cyclic AMP)
7. Provide for rapid chemical and electrical communication between the cells
a. Pancreatic cells (signaling to release insulin) & cardiac muscle cells (contract in unison)
E. Plasmodesmata - plants
1. Because have cell walls, don’t need desmosomes for strength
2. Cell walls isolate the cells
3. Plasmodesmata are channels about 20 - 40 nm wide through adjacent cells walls, connect cytoplasm
4. Plasmotubule - narrow cylindrical structure that runs through plasmodesmata and connects smooth ER of the two cells
5. Allows for passage of molecules and ions but not organelles
6. Allows for a type of slow electrical signaling in plants
7. Plasmodesmata channels can be dilated
Chapter 6 Outline
Cell Communication
General cell signaling (See Figure 6-2, page 136)
I. Signal of some sort is sent
A. Direct contact
1. Some immune cells - make direct contact and ligand on one cell binds to receptor on target cell
B. Local regulators
1. Signaling molecule that diffuses through the interstitial fluid and acts on neighboring cells
2. Called paracrine regulation
3. Types of local regulators:
a. Growth factors - typically peptides, stimulate cell division and normal development in specific cell types
b. Histamine - stored in E cells (check) and are released in response to allergic reactions, injury, infection, cause blood vessels to dilate and capillaries to become more permeable - allow passage of responding cells
c. Prostaglandins - modify cAMP levels and interact with other signaling molecules to either contract or relax smooth muscle
d. Nitric oxide - gas, many functions including dilation of blood vessels, decreasing blood pressure
C. Neurotransmitters
1. Chemical compounds released by neurons to signal one another
2. Diffuse across synapses - gaps between the neutrons
D. Hormones/long distance
1. Chemical messengers secreted by endocrine glands
1. No ducts - secreted into interstitial fluid, diffuse into capillaries
2. Transported by blood to target cells
II. Signal is received by target cell - signal molecule binds to membrane receptor or intracellular receptor and activates the receptor
A. Membrane receptors
1. Genes in cell code for specific receptors to be expressed on surface of the cell - proteins or glycoproteins
2. Recognize a specific ligand from a signaling cell - ligand is generally hydrophilic
3. 3 domains - domain is a structural and functional region of the protein
4. Receptor domains:
a. External docking domain - interacts with the ligand
b. Transmembrane domain
c. Intracellular ‘tail’ domain - transmits the signal within the cell
5. Types of membrane receptors (page 139) - all transmembrane proteins
6. Ion channel-linked receptors/ligand-gated channels
a. Converts chemical signals into electrical signals
b. Receptor may serve as the channel - opens or closes in response to binding of the ligand
c. Example: Acetylcholine
• Neurotransmitter that binds to an acetylcholine receptor - ligand-gated sodium ion channel
• Sodium channel opens, causing influx of sodium into the cell
• Decreases electric charge difference across the membrane (depolarization) which leads to muscle contraction
2. G-protein-linked receptors/G protein-coupled receptors
a. Transmembrane proteins that loop back and forth through the membrane 7 times - α-helixes
b. Intracellular portion (loops) have a binding site for a specific G-protein
c. G-proteins bind GTP, change shape, interact with another signal transduction protein
d. Discuss G-proteins more with signal transduction
3. Enzyme-linked receptors
a. Function directly as enzymes or are linked to enzymes
b. External binding site for ligand, enzyme component inside the cell
c. Example: Tyrosine kinases
• Bind growth factors
• Tyrosine kinases phosphorylates tyrosine residues on signal transduction protein(s) inside cell
• Phosphorylation - transfer of the terminal phophate group from an ATP molecule to the hydroxyl group on a target protein. In this case, the tyrosine residue of the target protein is phosphorylated.
• Phosphorylations changes shape of the target molecule, cause a new behavior or activation of behavior
B. Intracellular receptors
1. Some signaling molecules are small, hydrophobic molecules
2. Diffuse through plasma membrane and bind with an intracellular receptor
3. Most intracellular receptors are transcription factors, proteins that regulate the expression of specific genes
4. Examples: cortisol, sex hormones, Vitamins A & D, nitric oxide
III. Signal transduction
A. Ion-gated/ligand gated receptor transduction - change in electrical potential of the membrane caused the signal transduction
B. G-proteins
1. In group called first messengers
2. Inactive state, three subunits
3. One subunit bound to GDP (guanine diphosphate) - inactive state
4. Ligand binds receptor, receptor causes GDP to be released from subunit
5. GDP replaced with GTP and disassociates from other subunits - associates with second messenger
6. G-protein subunit is a GTPase - catalyzes conversion of GTP to GDP, returns to inactive state bound to other two subunits
C. Second messengers
1. Ions or small molecules that relay signal inside the cell
2. Second messengers may be produced in large amounts from one receptor-ligand interaction, amplifying the signal
3. Diffuse through cytosol or membrane to next target
4. Signaling cascade - a chain of molecules in the cell that relays signal
5. Second messenger examples:
a. Ca2+ ions - Ca2+ gates open, allow influx of Ca2+, Ca2+ binds to calmodulin, calmodulin changes shape and activates other enzymes
b. Phospholipids - G-protein activates membrane-bound phopholipase C, splits membrane phopholipid PIP2 into IP3 and DAG, both second messengers
c. cAMP (page 141)
• G-protein GTPase subunit interacts with adenylyl cyclase
• Adenylyl cyclase converts ATP to cAMP
• cAMP interacts with next target molecule, could be an enzyme that alters metabolism, a protein that alters gene activity, or a protein that opens or closes ion channels
• cAMP activates protein kinase A - protein kinase A physphoylates other molecules
D. Scaffolding proteins
1. Increase efficiency of the signal cascade
2. Organize the intracellular signaling molecules into signaling complexes
3. Position enzymes close to their substrates
IV. Response of the target cell
A. Ion channels open or close
B. Enzyme activity is altered - metabolic change or other effects
C. Specific gene activity may be turned on or off - changes in cell shape, growth, cell division, cell differentiation
D. Signal termination
1. Signal must be stopped or cell can’t respond to new signals
2. Returns receptor and signal transduction components back to the inactive state
3. Phosphorylated enzymes dephosporylated, etc.
E. Example of cell responce: Cholera
1. Normal scenario:
a. Ligand bonds to receptor in intestinal cell
b. Receptor activates G-protein
c. G-protein activates Adenylyl cyclase
d. Andenylyl cyclase converts ATP to cAMP
e. cAMP activates ion channel which allows chlorine ions into the intestine
f. Water follows
2. Cholera:
a. Toxin activates G-protein but doesn’t allow conversion of GTP to GDP - G-protein always on
b. Chlorine ions flood the intestine along with water
c. Patient dies of dehydration caused by sever diarrhea
Subscribe to:
Posts (Atom)






